BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18902

Title: Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes   PubMed: 24005038

Authors: Agrawal, Prashansa; Hatzakis, Emmanuel; Guo, Kexiao; Carver, Megan; Yang, Danzhou

Citation: Agrawal, Prashansa; Hatzakis, Emmanuel; Guo, Kexiao; Carver, Megan; Yang, Danzhou. "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes."  Nucleic Acids Res. 41, 10584-10592 (2013).

Assembly members:
major_G-quadruplex, polymer, 22 residues, 6922.468 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
major_G-quadruplex: CGGGGCGGGCCTTGGGCGGG GT

Data sets:
Data typeCount
1H chemical shifts202

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1major_G-quadruplex1

Entities:

Entity 1, major_G-quadruplex 22 residues - 6922.468 Da.

1   DCDGDGDGDGDCDGDGDGDC
2   DCDTDTDGDGDGDCDGDGDG
3   DGDT

Samples:

sample_1: major_G-quadruplex 0.2 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 100 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH, Brunger - geometry optimization, refinement, structure solution

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: