BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18892

Title: Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA   PubMed: 16452301

Authors: Cash, Darian; Richards, Rebecca; Theimer, Carla; Finger, David; Feigon, Juli

Citation: Richards, Rebecca; Theimer, Carla; Finger, David; Feigon, Juli. "Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA"  Nucleic Acids Res. 34, 816-825 (2006).

Assembly members:
helixII_telo_RNA, polymer, 23 residues, 7387.508 Da.

Natural source:   Common Name: tetrahymena thermophila   Taxonomy ID: 5911   Superkingdom: Eukaryota   Kingdom: not available   Genus/species: tetrahymena thermophila

Experimental source:   Production method: enzymatic synthesis   Host organism: n/a

Entity Sequences (FASTA):
helixII_telo_RNA: GGCAGAUCUGUAAUAGAACU GCC

Data sets:
Data typeCount
13C chemical shifts151
15N chemical shifts34
1H chemical shifts184

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1helixII_telo_RNA1

Entities:

Entity 1, helixII_telo_RNA 23 residues - 7387.508 Da.

1   GGCAGAUCUG
2   UAAUAGAACU
3   GCC

Samples:

sample_1: helixII_telo_RNA, unlabeled, 0.6 – 1.0 mM; sodium phosphate 10 mM; potassium chloride 30 mM; EDTA 50 uM; sodium azide 0.2%; H2O 90%; D2O 10%

sample_2: helixII_telo_RNA, 13C,15N uniformly labelled, 0.6 – 1.0 mM; sodium phosphate 10 mM; potassium chloride 30 mM; EDTA 50 uM; sodium azide 0.2%; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 30 mM; pH: 6.3; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 30 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
11echo and watergatesample_1isotropicsample_conditions_1
2D TOCSYsample_1isotropicsample_conditions_2
2D NOESYsample_1isotropicsample_conditions_2
2D 15N-HMQC, 2D 15N-CPMG-NOESY, 2D JNN-HNN-COSYsample_2isotropicsample_conditions_1
2D 13C-HSQCssample_2isotropicsample_conditions_2
2D HCCH COSY, 3D HCCH-TOCSYsample_2isotropicsample_conditions_2
3D 1H,13C HMQCssample_2isotropicsample_conditions_2

Software:

X-PLOR NIH v2.9.8, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

SPARKY, Goddard - data analysis, peak picking

xwinnmr, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker DRX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: