BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18891

Title: Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop   PubMed: 16809815

Authors: Cash, Darian; Richards, Rebecca; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine; Feigon, Juli; Collins, Kathleen

Citation: Richards, Rebecca; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine; Collins, Kathleen; Feigon, Juli. "Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop"  RNA 12, 1475-1485 (2006).

Assembly members:
stemIV_telo_RNA, polymer, 21 residues, 6650.027 Da.

Natural source:   Common Name: tetrahymena thermophila   Taxonomy ID: 5911   Superkingdom: Eukaryota   Kingdom: not available   Genus/species: tetrahymena thermophila

Experimental source:   Production method: enzymatic synthesis   Host organism: n/a

Entity Sequences (FASTA):
stemIV_telo_RNA: GGCGAUACACUAUUUAUCGC C

Data sets:
Data typeCount
13C chemical shifts141
15N chemical shifts19
1H chemical shifts181

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1stemIV_telo_RNA1

Entities:

Entity 1, stemIV_telo_RNA 21 residues - 6650.027 Da.

1   GGCGAUACAC
2   UAUUUAUCGC
3   C

Samples:

sample_1: stemIV_telo_RNA, unlabeled, 0.6 – 1.0 mM; potassium chloride 20 mM; sodium azide 0.2%; EDTA 50 uM; sodium phosphate 10 mM; H2O 90%; D2O 10%

sample_2: stemIV_telo_RNA, 13C,15N uniformly labelled, 0.6 – 1.0 mM; sodium phosphate 10 mM; potassium chloride 20 mM; sodium azide 0.2%; EDTA 50 uM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 20 mM; pH: 6.3; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 20 mM; pH: 6.3 M; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
11echo and watergatesample_1isotropicsample_conditions_1
2D TOCSYsample_1isotropicsample_conditions_2
2D NOESYsample_1isotropicsample_conditions_2
2D 15N-HMQC, 2D 15N-CPMG-NOESY, 2D JNN-HNN-COSYsample_2isotropicsample_conditions_1
2D 13C-HSQCssample_2isotropicsample_conditions_2
2D HCCH COSY, 3D HCCH-TOCSYsample_2isotropicsample_conditions_2
3D 1H,13C HMQCssample_2isotropicsample_conditions_2

Software:

X-PLOR NIH v2.9.8, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

SPARKY, Goddard - data analysis, peak picking

xwinnmr, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 800 MHz
  • Bruker DRX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: