BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18838

Title: Solution structure of the ID3 stem loop of domain 1 in the ai5gamma group II intron   PubMed: 24243113

Authors: Popovic, Milena; Greenbaum, Nancy

Citation: Popovic, Milena; Greenbaum, Nancy. "Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site."  RNA 20, 24-35 (2014).

Assembly members:
ID3, polymer, 23 residues, 132.116 Da.

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
ID3: GGGUGUAUUGGAAAUGAGCA CCC

Data sets:
Data typeCount
13C chemical shifts132
1H chemical shifts158

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1ID3 stem loop1

Entities:

Entity 1, ID3 stem loop 23 residues - 132.116 Da.

1   GGGUGUAUUG
2   GAAAUGAGCA
3   CCC

Samples:

sample_1: ID30.03 – 0.9 mM; sodium chloride 60 mM; H2O 90%; D2O 10%

sample_2: ID30.03 – 0.9 mM; sodium chloride 60 mM; D2O 100%

sample_3: ID3, [U-100% 13C; U-100% 15N], 0.3 – 0.5 mM; sodium chloride 60 mM; H2O 90%; D2O 10%

sample_4: ID3, [U-100% 13C; U-100% 15N], 0.3 – 0.5 mM; potassium chloride 60 mM; D2O 100%

sample_conditions_1: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 277 K

sample_conditions_2: ionic strength: 0.06 M; pH: 6.4; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D DQF-COSYsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_4isotropicsample_conditions_2
2D 1H-13C HSQC aromaticsample_4isotropicsample_conditions_2
3D 1H-15N NOESYsample_3isotropicsample_conditions_2
3D HCCH-COSYsample_4isotropicsample_conditions_2
3D HCCH-TOCSYsample_4isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

CCPN, CCPN - chemical shift assignment

TOPSPIN, Bruker Biospin - collection, processing

SPARKY, Goddard - chemical shift assignment

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: