BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18633

Title: solution structure of small molecule-influenza RNA complex, Seattle Structural Genomics Center for Infectious Disease (SSGCID)   PubMed: 24247110

Authors: Lee, M.; Varani, G.; Choi, B.; Pellecchia, M.

Citation: Lee, Mi-Kyung; Bottini, Angel; Kim, Meehyein; Bardaro, Michael; Zhang, Ziming; Pellecchia, Maurizio; Choi, Byong-Seok; Varani, Gabriele. "A novel small-molecule binds to the influenza A virus RNA promoter and inhibits viral replication."  Chem. Commun. (Camb.) 50, 368-370 (2014).

Assembly members:
influenza_A_virus_RNA_promoter, polymer, 32 residues, 10258.172 Da.
6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine, non-polymer, 289.333 Da.

Natural source:   Common Name: influenza A virus   Taxonomy ID: 11320   Superkingdom: not available   Kingdom: Viruses   Genus/species: not available Influenzavirus A

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
influenza_A_virus_RNA_promoter: GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU

Data sets:
Data typeCount
1H chemical shifts186

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1influenza A virus RNA promoter1
26,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine2

Entities:

Entity 1, influenza A virus RNA promoter 32 residues - 10258.172 Da.

1   GAGUAGAAAC
2   AAGGCUUCGG
3   CCUGCUUUUG
4   CU

Entity 2, 6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine - C14 H19 N5 O2 - 289.333 Da.

1   0EC

Samples:

sample_1: influenza A virus RNA promoter 1 mM; sodium chloride 50 mM; phosphate buffer 20 mM; D2O 10%; H2O 90%

sample_2: influenza A virus RNA promoter 1 mM; sodium chloride 50 mM; phosphate buffer 20 mM; D2O 100%

sample_conditions_1: ionic strength: 50 mM; pH: 6.0; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
H2O NOESYsample_1isotropicsample_conditions_1
D2O NOESYsample_2isotropicsample_conditions_1

Software:

X-PLOR NIH, Brunger - refinement

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DRX 600 MHz

Related Database Links: