BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18549

Title: Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA

Authors: Nikonowicz, Edward; Wang, Jiachen; Moran, Sean; Donarski, James

Citation: Moran, Sean; Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA"  Not known ., .-..

Assembly members:
RNA, polymer, 24 residues, 132.116 Da.

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA: GGGCUAAUGUUGAAAAAUUA GCCC

Data sets:
Data typeCount
13C chemical shifts181
15N chemical shifts42
1H chemical shifts185

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1

Entities:

Entity 1, RNA 24 residues - 132.116 Da.

1   GGGCUAAUGU
2   UGAAAAAUUA
3   GCCC

Samples:

CN_D2O: RNA, [U-99% 13C; U-99% 15N], 1.2 ± 0.1 mM; potassium phosphate 10 ± 1.0 mM; sodium chloride 10 ± 1.0 mM; EDTA 0.1 ± 0.5 mM; D2O 100%

NatAb_D2O: RNA 1.6 ± 0.1 mM; potassium phosphate 10 ± 1.0 mM; sodium chloride 10 ± 1.0 mM; EDTA 0.1 ± 0.5 mM; D2O 100%

NatAb_H2O: RNA 1.6 ± 0.1 mM; potassium phosphate 10 ± 1.0 mM; sodium chloride 10 ± 1.0 mM; EDTA 0.1 ± 0.5 mM; D2O 10%; H2O 90%

CN_H2O: RNA, [U-99% 13C; U-99% 15N], 1.2 ± 0.1 mM; potassium phosphate 10 ± 1.0 mM; sodium chloride 10 ± 1.0 mM; EDTA 0.1 ± 0.5 mM; D2O 10%; H2O 90%

25C: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

10C: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCCN_H2Oisotropic10C
2D 1H-13C HSQCCN_D2Oisotropic25C
3D HCCH-TOCSYCN_D2Oisotropic25C
3D 1H-13C NOESYCN_D2Oisotropic25C
2D 1H-1H NOESYNatAb_D2Oisotropic25C
2D DQF-COSYNatAb_D2Oisotropic25C
2D 1H-1H NOESYNatAb_H2Oisotropic10C
3D HCCH-COSYCN_D2Oisotropic25C
2D 1H-31P HetCorNatAb_D2Oisotropic25C
2D 1H-15N HMQCCN_D2Oisotropic25C
2D 1H-13C ctHSQC-31PCN_D2Oisotropic25C
2D 1H-15N HCNCN_D2Oisotropic25C
3D 1H-15N NOESYCN_H2Oisotropic10C

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

FELIX, Accelrys Software Inc. - processing, refinement

VNMR, Varian - collection, refinement

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 500 MHz

Related Database Links: