BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18534

Title: RDC REFINED SOLUTION STRUCTURE OF DOUBLE-STRANDED RNA BINDING DOMAIN OF S. CEREVISIAE RNASE III (RNT1P) IN COMPLEX WITH THE TERMINAL RNA HAIRPIN OF SNR47 PRECURSOR   PubMed: 21742266

Authors: Wang, Zhonghua; Feigon, Juli

Citation: Wang, Zhonghua; Hartman, Elon; Roy, Kevin; Chanfreau, Guillaume; Feigon, Juli. "Structure of a yeast RNase III dsRBD complex with a noncanonical RNA substrate provides new insights into binding specificity of dsRBDs."  Structure 19, 999-1010 (2011).

Assembly members:
Ribonuclease III, polymer, 90 residues, 9822.442 Da.
RNA (32-MER), polymer, 32 residues, 9822.442 Da.

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
Ribonuclease III: GSLDMNAKRQLYSLIGYASL RLHYVTVKKPTAVDPNSIVE CRVGDGTVLGTGVGRNIKIA GIRAAENALRDKKMLDFYAK QRAAIPRSES
RNA (32-MER): GGGAUACCAUGUUCAGAAGA ACGUGGUAUCUC

Data sets:
Data typeCount
13C chemical shifts487
15N chemical shifts90
1H chemical shifts740

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Ribonuclease III1
2RNA (32-MER)2

Entities:

Entity 1, Ribonuclease III 90 residues - 9822.442 Da.

1   GLYSERLEUASPMETASNALALYSARGGLN
2   LEUTYRSERLEUILEGLYTYRALASERLEU
3   ARGLEUHISTYRVALTHRVALLYSLYSPRO
4   THRALAVALASPPROASNSERILEVALGLU
5   CYSARGVALGLYASPGLYTHRVALLEUGLY
6   THRGLYVALGLYARGASNILELYSILEALA
7   GLYILEARGALAALAGLUASNALALEUARG
8   ASPLYSLYSMETLEUASPPHETYRALALYS
9   GLNARGALAALAILEPROARGSERGLUSER

Entity 2, RNA (32-MER) 32 residues - 9822.442 Da.

1   GGGAUACCAU
2   GUUCAGAAGA
3   ACGUGGUAUC
4   UC

Samples:

sample_1: Ribonuclease III, [U-100% 13C; U-100% 15N], 1 mM; H2O 90%; D2O, [U-100% 2H], 10%; sodium phosphate 20 mM; sodium chloride 150 mM

sample_2: Ribonuclease III, [U-100% 13C; U-100% 15N], 1 mM; D2O, [U-100% 2H], 100%; sodium chloride 10 mM; sodium phosphate 150 mM

sample_conditions_1: ionic strength: 150 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HBHA(CO)NHsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
3D HCCH-COSYsample_2isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_2isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis

TALOS, Cornilescu, Delaglio and Bax - data analysis

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DRX 600 MHz

Related Database Links:

PDB
BMRB 17574 18535
DBJ GAA25690
EMBL CAA90210 CAY82070
GB AAB04172 AHY76694 AJP40933 AJS62105 AJS62540
REF NP_013966
SP Q02555
TPG DAA10139