BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18532

Title: RNA Aptamer for B. anthracis Ribosomal Protein S8

Authors: Nikonowicz, Edward; Wang, Jiachen

Citation: Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "An RNA Aptamer Takes an Unexpected Twist to Bind r-Protein S8"  Unknown ., .-..

Assembly members:
RNA, polymer, 28 residues, 111.103 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA: GGGCAGUGAUGCUUCGGCAU AUCAGCCC

Data sets:
Data typeCount
13C chemical shifts201
15N chemical shifts65
1H chemical shifts195

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA, 11
2RNA, 21
3RNA, 31
4RNA, 41
5RNA, 51
6RNA, 61
7RNA, 71
8RNA, 81
9RNA, 91

Entities:

Entity 1, RNA, 1 28 residues - 111.103 Da.

1   GGGCAGUGAU
2   GCUUCGGCAU
3   AUCAGCCC

Samples:

sample_1: RNA, [U-98% 13C; U-98% 15N], 1.5 ± 0.1 mM; H2O 90%; D2O, [U-2H], 10%

sample_2: RNA, [U-98% 13C; U-98% 15N], 1.6 ± 0.1 mM; D2O, [U-2H], 100%

sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 50 mM; pH*: 6.8; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
3D 1H-13C NOESYsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
3D HCCH-COSYsample_2isotropicsample_conditions_2
3D 1H-13C NOESYsample_2isotropicsample_conditions_2
3D HCCH-TOCSYsample_2isotropicsample_conditions_2
2D 1H-31P HetCorsample_2isotropicsample_conditions_2
2D 1H-15N HNC-TOCSY-CHsample_1isotropicsample_conditions_2
2D 1H-13C H(N)COsample_1isotropicsample_conditions_1
2D 1H-13C CCH-COSYsample_2isotropicsample_conditions_2
2D 1H-13C HCNCsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_2isotropicsample_conditions_2
2D 1H-15N HCNsample_2isotropicsample_conditions_2

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

FELIX, Accelrys Software Inc. - data analysis

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz
  • Varian INOVA 500 MHz

Related Database Links: