BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18503

Title: NMR solution structure of the kappa-zeta region of S.cerevisiae group II intron ai5(gamma)   PubMed: 23275550

Authors: Donghi, Daniela; Pechlaner, Maria; Finazzo, Cinzia; Knobloch, Bernd; Sigel, Roland

Citation: Donghi, Daniela; Pechlaner, Maria; Finazzo, Cinzia; Knobloch, Bernd; Sigel, Roland. "The structural stabilization of the three-way junction by Mg(II) represents the first step in the folding of a group II intron."  Nucleic Acids Res. 41, 2489-2504 (2013).

Assembly members:
RNA_(49-MER), polymer, 49 residues, 15800.554 Da.

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis   Host organism: cell free synthesis (using T7 polymerase)

Entity Sequences (FASTA):
RNA_(49-MER): GGAAUAUGCUCAACGAAAGU GAAUCAGCUUCGGCUGAGAG CUAAGUUCC

Data sets:
Data typeCount
13C chemical shifts312
15N chemical shifts95
1H chemical shifts550

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (49-MER)1

Entities:

Entity 1, RNA (49-MER) 49 residues - 15800.554 Da.

This construct represents residues 195-218 and 374-386 of group II intron ai5(gamma); residues 1,2,48 and 49 as well as residues 27-34 are additions that are not present in the intron.

1   GGAAUAUGCU
2   CAACGAAAGU
3   GAAUCAGCUU
4   CGGCUGAGAG
5   CUAAGUUCC

Samples:

D1kz_wt_d2o: RNA (49-MER) 0.3-1.0 mM; potassium chloride 60 mM; EDTA 10 uM; magnesium chloride 0-12 mM

D1kz_deut_d2o: RNA (49-MER), [3, ; 2, 2, ; 2, 3, ; 2, 4, ; 2

D1kz_lab_d2o: RNA (49-MER), [100% 13C; 100% 15N], 0.3-1 mM; potassium chloride 60 mM; EDTA 10 uM; magnesium chloride 0-12 mM

D1kz_wt_h2o: RNA (49-MER) 0.3-1.0 mM; potassium chloride 60 mM; EDTA 10 uM; magnesium chloride 0-12 mM

D1kz_lab_h2o: RNA (49-MER), [U-100% 13C; U-100% 15N], 0.3-1.0 mM; potassium chloride 60 mM; EDTA 10 uM; magnesium chloride 0-12 mM

300K_d2o: ionic strength: 60 mM; pD: 6.7; pressure: 1 atm; temperature: 300 K

275-285K_h2o: ionic strength: 60 mM; pH: 6.7; pressure: 1 atm; temperature: 280 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYD1kz_wt_d2oisotropic300K_d2o
2D 1H-1H NOESYD1kz_wt_d2oisotropic300K_d2o
2D 1H-1H NOESYD1kz_deut_d2oisotropic300K_d2o
2D 1H-1H NOESYD1kz_wt_h2oisotropic275-285K_h2o
2D 1H-15N HSQCD1kz_lab_h2oisotropic275-285K_h2o
2D 1H-13C HSQCD1kz_lab_d2oisotropic300K_d2o
3D 1H-13C NOESY aliphaticD1kz_wt_d2oisotropic300K_d2o
2D JNN HNN COSYD1kz_lab_h2oisotropic275-285K_h2o
2D 1H-15N HSQCD1kz_lab_d2oisotropic300K_d2o

Software:

CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution

SPARKY, Goddard - chemical shift assignment, data analysis, peak integration

X-PLOR NIH v2.30, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

Molmol, Koradi, Billeter and Wuthrich - data analysis

TOPSPIN, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 900 MHz

Related Database Links: