BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18336

Title: Structure of the RNA claw of the DNA packaging motor of bacteriophage 29   PubMed: 22879380

Authors: Harjes, Elena; Matsuo, Hiroshi; Kitamura, Aya

Citation: Harjes, Elena; Kitamura, Aya; Zhao, Wei; Morais, Marc; Jardine, Paul; Grimes, Shelley; Matsuo, Hiroshi. "Structure of the RNA claw of the DNA packaging motor of bacteriophage 29."  Nucleic Acids Res. 40, 9953-9963 (2012).

Assembly members:
RNA_(27-MER), polymer, 27 residues, 8586.186 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: Phi 29

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
RNA_(27-MER): GGACUUCCAUUGCUUCGGCA AAAGUCC

Data sets:
Data typeCount
13C chemical shifts69
15N chemical shifts9
1H chemical shifts209

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (27-MER)1

Entities:

Entity 1, RNA (27-MER) 27 residues - 8586.186 Da.

1   GGACUUCCAU
2   UGCUUCGGCA
3   AAAGUCC

Samples:

sample_1: RNA (27-MER), [U-100% 13C; U-100% 15N], 300 uM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1anisotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_1anisotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1anisotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1

Software:

CNS, Brunger A. T. et.al. - refinement

NMR spectrometers:

  • Varian INOVA 800 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 900 MHz

Related Database Links: