BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18034

Title: UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops   PubMed: 22605553

Authors: Zhao, Q.; Huang, H.; Nagaswamy, U.; Xia, Y.; Gao, X.; Fox, George

Citation: Zhao, Qin; Huang, Hung-Chung; Nagaswamy, Uma; Xia, Youlin; Gao, Xiaolian; Fox, George. "UNAC tetraloops: to what extent do they mimic GNRA tetraloops?"  Biopolymers 97, 617-628 (2012).

Assembly members:
UUAC, polymer, 22 residues, 7093.14882 Da.

Natural source:   Common Name: Haloarcula marismortui   Taxonomy ID: 2238   Superkingdom: Archaea   Kingdom: not available   Genus/species: Haloarcula marismortui

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
UUAC: GGACCCGGCUUACGCUGGGU CC

Data sets:
Data typeCount
1H chemical shifts89

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1UUAC1

Entities:

Entity 1, UUAC 22 residues - 7093.14882 Da.

1   GGACCCGGCU
2   UACGCUGGGU
3   CC

Samples:

sample_1: UUAC, [U-13C; U-15N], 0.3 mM; D2O 99.96%

sample_conditions_1: pH: 7.000; pressure: 1 atm; temperature: 298.000 K

Experiments:

NameSampleSample stateSample conditions
experiment_1sample_1solutionsample_conditions_1

Software:

AutoDep v4.3, AutoDep - chemical shift assignment

CNS vany, BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE- - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links:

PDB