BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17972

Title: U2/U6 Helix I   PubMed: 22328579

Authors: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel

Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex."  RNA 18, 673-683 (2012).

Assembly members:
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_, polymer, 24 residues, 7716.717 Da.

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis   Host organism: E. coli - cell free

Entity Sequences (FASTA):
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_: GGCUUAGAUCAGAAAUGAUC AGCC

Data sets:
Data typeCount
13C chemical shifts80
1H chemical shifts167

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U2_U6snRNA1

Entities:

Entity 1, U2_U6snRNA 24 residues - 7716.717 Da.

1   GGCUUAGAUC
2   AGAAAUGAUC
3   AGCC

Samples:

sample_1: RNA0.5 – 0.6 mM; H2O 90%; D2O 10%

sample_2: RNA0.5 – 0.6 mM; D2O 100%

sample_3: RNA, [U-98% 13C; U-98% 15N], 0.3 mM; H2O 90%; D2O 10%

sample_4: RNA, [U-98% 13C; U-98% 15N], 0.3 mM; D2O 100%

sample_5: RNA, [U-98% 13C; U-98% 15N], 0.3 mM; Pf1 phage 17 mg/ml; H2O 90%; D2O 10%

sample_6: RNA, [U-98% 13C; U-98% 15N], 0.3 mM; Pf1 phage 17 mg/ml; D2O 100%

sample_7: RNA0.5 – 0.6 mM; Pf1 phage 18 mg/ml; D2O 100%

sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_2isotropicsample_conditions_2
2D 1H-15N HMQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_4isotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_4isotropicsample_conditions_2
2D 1H-15N HMQCsample_5anisotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_6anisotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_6anisotropicsample_conditions_2
2D HNN-COSYsample_3isotropicsample_conditions_1
3D HCCH-TOCSYsample_4isotropicsample_conditions_2
3D HCCH-COSYsample_4isotropicsample_conditions_2

Software:

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

xwinnmr v3.5, Bruker Biospin - collection, processing

VNMRJ v1.1, Varian - collection

NMRPipe v97.027.12.56, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking

X-PLOR NIH v2.21, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker DMX 750 MHz
  • Varian INOVA 600 MHz

Related Database Links: