BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17961

Title: S. cerevisiae U2/U6 snRNA complex   PubMed: 22328579

Authors: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel

Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex."  RNA 18, 673-683 (2012).

Assembly members:
U2U6111, polymer, 111 residues, Formula weight is not available

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis   Host organism: E. coli - cell free

Entity Sequences (FASTA):
U2U6111: GGCAAUACAGAGAUGAUCAG CAGUUCCCCUGCAUAAGGAU GAACCGUUUUACAAAGAGAU UUCUUCGGGAAUCUCUUUGC CUUUUGGCUUAGAUCAAGUG UAGUAUCUGUC

Data typeCount
15N chemical shifts54
1H chemical shifts140

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U2U61111

Entities:

Entity 1, U2U6111 111 residues - Formula weight is not available

1   GGCAAUACAG
2   AGAUGAUCAG
3   CAGUUCCCCU
4   GCAUAAGGAU
5   GAACCGUUUU
6   ACAAAGAGAU
7   UUCUUCGGGA
8   AUCUCUUUGC
9   CUUUUGGCUU
10   AGAUCAAGUG
11   UAGUAUCUGU
12   C

Samples:

sample_1: U2U6111 0.6-0.8 mM; potassium phosphate 20 mM

sample_2: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.6-0.8 mM; potassium phosphate 20 mM

sample_3: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.3-0.5 mM; potassium phosphate 20 mM; magnesium chloride 2 mM

sample_4: U2U6111 0.6-0.8 mM; potassium phosphate 20 mM; magnesium chloride 2 mM

sample_5: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.3-0.5 mM; potassium phosphate 20 mM; magnesium chloride 2 mM; Pf1 phage 10 mg/ml

sample_conditions_1: ionic strength: 20 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HMQCsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-15N HMQCsample_4isotropicsample_conditions_1
2D 1H-15N TROSY-HMQCsample_2isotropicsample_conditions_1
2D 1H-15N TROSY-HMQCsample_4isotropicsample_conditions_1
2D 1H-15N HMQCsample_5anisotropicsample_conditions_1
2D 1H-15N TROSY-HMQCsample_5anisotropicsample_conditions_1

Software:

SPARKY v3.114, Goddard - chemical shift assignment

TOPSPIN v2.1, Bruker Biospin - processing

MC-SYM v4.2.2, Parisien, Major - structure solution

X-PLOR NIH v2.21, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 750 MHz

Related Database Links: