BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17941

Title: the structure of subdomain IV-B from the CVB-3 IRES

Authors: Ihle, Yvonne; Zell, Roland; Goerlach, Matthias

Citation: Ihle, Yvonne. "The Structure of Subdomain IV-B from the CVB-3 IRES"  Not known ., .-..

Assembly members:
IV-B_RNA, polymer, 27 residues, 8600.216 Da.

Natural source:   Common Name: Coxsackievirus B3   Taxonomy ID: 12072   Superkingdom: Viruses   Kingdom: not available   Genus/species: Enterovirus Human enterovirus B

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
IV-B_RNA: GGCCUCAGCACUACCCCAGU GUAGGUC

Data sets:
Data typeCount
13C chemical shifts179
15N chemical shifts47
1H chemical shifts243
31P chemical shifts2

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1IV-B_RNA1

Entities:

Entity 1, IV-B_RNA 27 residues - 8600.216 Da.

Residues 290-292 and 314-316 are non-native and were attached facilitating transcription and purification.

1   GGCCUCAGCA
2   CUACCCCAGU
3   GUAGGUC

Samples:

15N-IVB: IV-B RNA, [U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 200 uM; H2O 90%; D2O 10%

13C_15N-IVB: IV-B RNA, [U-100% 13C; U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 200 uM; D2O 100%

(C_A-13C_15N)-IVB: IV-B RNA, [U-13C; U-15N]-Ade,Cyt, 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 200 uM; D2O 100%

(G_U-13C_15N)-IVB: IV-B RNA, [U-13C; U-15N]-Gua,Ura, 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 200 uM; D2O 100%

sample_conditions_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 273 K

sample_conditions_2: pH: 6.2; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQC15N-IVBisotropicsample_conditions_1

Software:

CYANA v1.1, Guntert, Mumenthaler and Wuthrich - structure solution

TOPSPIN v2.1, Bruker Biospin - collection, processing

CARA v1.5.5, Rochus Keller - chemical shift assignment, peak picking

CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - refinement

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 750 MHz

Related Database Links:

GB M88483.1