BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17921

Title: Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.

Authors: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel

Citation: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel. "Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant."  The BMRB entry is the only known published source for the data..

Assembly members:
TECTO47, polymer, 47 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
TECTO47: GGAGGAUAUGGAAGAACCGG GGUGACUUGGUUCUUCCUAA GUCCUCC

Data sets:
Data typeCount
15N chemical shifts22
1H chemical shifts32

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1GAAA tetraloop monomer1

Entities:

Entity 1, GAAA tetraloop monomer 47 residues - Formula weight is not available

1   GGAGGAUAUG
2   GAAGAACCGG
3   GGUGACUUGG
4   UUCUUCCUAA
5   GUCCUCC

Samples:

sample_unlabeled: TECTO47 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%

sample_labeled: TECTO47, [U-100% 13C; U-100% 15N], 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_labeledisotropicsample_conditions_1
2D 1H-1H NOESYsample_unlabeledisotropicsample_conditions_1

Software:

xwinnmr v3.5, Bruker Biospin - collection, processing

SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker DMX 750 MHz
  • Varian INOVA 900 MHz

Related Database Links: