BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17877

Title: Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch   PubMed: 22976989

Authors: Korth, Maximiliane; Sigel, Roland

Citation: Korth, Maximiliane; Sigel, Roland. "Unusually high-affinity Mg(2+) binding at the AU-rich sequence within the antiterminator hairpin of a Mg(2+) riboswitch."  Chem. Biodivers. 9, 2035-2049 (2012).

Assembly members:
RNA_(32-MER), polymer, 32 residues, 10304.251 Da.

Natural source:   Common Name: Yersinia enterocolitica   Taxonomy ID: 630   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Yersinia enterocolitica

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
RNA_(32-MER): GGACCGAUAAGGUAGAAAUG CCUUAUCGGUCC

Data sets:
Data typeCount
1H chemical shifts232

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (32-MER)1

Entities:

Entity 1, RNA (32-MER) 32 residues - 10304.251 Da.

1   GGACCGAUAA
2   GGUAGAAAUG
3   CCUUAUCGGU
4   CC

Samples:

sample_1: potassium chloride 50 mM; EDTA 10 uM; RNA (32-MER) 0.24 mM; D2O 100%

sample_2: potassium chloride 50 mM; EDTA 10 uM; RNA (32-MER) 0.6 mM; D2O 10%; H2O 90%

sample_3: potassium chloride 50 mM; EDTA 10 uM; RNA (32-MER) 0.8 mM; D2O 100%

sample_4: potassium chloride 50 mM; EDTA 10 uM; RNA (32-MER) 0.5 mM; D2O 100%

sample_conditions_1: ionic strength: 0.05 M; pH: 6.8; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 0.05 M; pH: 6.8; pressure: 1 atm; temperature: 278 K

sample_conditions_3: ionic strength: 0.05 M; pH: 6.8; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_4isotropicsample_conditions_3

Software:

CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

TOPSPIN v1.3, 2.1, 3.0a, Bruker Biospin - processing

X-PLOR v2.24, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: