BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17861

Title: high resolution NMR solution structure of helix H1 of the human HAR1F RNA   PubMed: 22961937

Authors: Cevec, Mirko; Koschinat, Melanie; Richter, Christian; Schwalbe, Harald

Citation: Ziegeler, Melanie; Cevec, Mirko; Richter, Christian; Schwalbe, Harald. "NMR studies of HAR1 RNA secondary structures reveal conformational dynamics in the human RNA."  Chembiochem 13, 2100-2112 (2012).

Assembly members:
RNA_(37-MER), polymer, 37 residues, 11887.177 Da.

Natural source:   Common Name: humans   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(37-MER): GGGUGAAACGGAGGACUUCG GUCCUCAAGUUUCACCC

Data sets:
Data typeCount
1H chemical shifts277

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (37-MER)1

Entities:

Entity 1, RNA (37-MER) 37 residues - 11887.177 Da.

1   GGGUGAAACG
2   GAGGACUUCG
3   GUCCUCAAGU
4   UUCACCC

Samples:

sample_1: RNA (37-MER), [U-100% 15N], 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_2: RNA (37-MER), [U-100% 15N], 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM; D2O 100%

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_2
2D HNN-COSYsample_1isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
3D 1H-15N NOESYsample_1isotropicsample_conditions_2
2D 1H-15N CPMG-NOESYsample_1isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1

Software:

ARIA v1.2, Linge, O, . - refinement

TOPSPIN v2.1, Bruker Biospin - collection, processing

SPARKY v3.113, Goddard - data analysis

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - refinement

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links: