BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17860

Title: high resolution NMR solution structure of helix H1 of the chimpanzee HAR1 RNA   PubMed: 22961937

Authors: Cevec, Mirko; Ziegeler, Melanie; Richter, Christian; Schwalbe, Harald

Citation: Ziegeler, Melanie; Cevec, Mirko; Richter, Christian; Schwalbe, Harald. "NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA"  Chembiochem 13, 2100-2112 (2012).

Assembly members:
RNA_(37-MER), polymer, 37 residues, 11872.162 Da.

Natural source:   Common Name: chimpanzee   Taxonomy ID: 9598   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Pan troglodytes

Experimental source:   Production method: chemical synthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(37-MER): GGGUGAAAUGGAGGACUUCG GUCCUCAAAUUUCACCC

Data sets:
Data typeCount
1H chemical shifts282

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (37-MER)1

Entities:

Entity 1, RNA (37-MER) 37 residues - 11872.162 Da.

1   GGGUGAAAUG
2   GAGGACUUCG
3   GUCCUCAAAU
4   UUCACCC

Samples:

sample_1: RNA (37-MER) 0.6 mM; potassium chloride 50 mM; potassium phosphate 25 mM

sample_2: RNA (37-MER), [U-100% 15N], 0.4 mM; potassium chloride 50 mM; potassium phosphate 25 mM

sample_3: RNA (37-MER), [U-13C; U-15N]-Ade,Ura, 0.3 mM; potassium chloride 50 mM; potassium phosphate 25 mM

sample_4: RNA (37-MER), [U-13C; U-15N]-Cyt,Gua, 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM

sample_5: RNA (37-MER), [U-13C; U-15N]-Cyt,Gua, 1 mM; potassium chloride 50 mM; potassium phosphate 25 mM

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_2isotropicsample_conditions_2
2D HNN-COSYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
3D 1H-13C-13C-TROSY relayed HCCH-COSYsample_4isotropicsample_conditions_1
2D 1H-13C HSQCsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_5isotropicsample_conditions_2
2D 1H-13C HCCNH-TOCSYsample_3isotropicsample_conditions_2
3D HCPsample_5isotropicsample_conditions_1
2D 1H-31P COSYsample_5isotropicsample_conditions_1
3D forward-directed HCC-TOCSY-CCH E.COSYsample_5isotropicsample_conditions_1
2D H(C)Nsample_5isotropicsample_conditions_1
2D HNCOsample_4isotropicsample_conditions_2
3D HCCH-TOCSYsample_5isotropicsample_conditions_1

Software:

ARIA v1.2, Linge, O, . - refinement

TOPSPIN v2.1, Bruker Biospin - collection, processing

SPARKY v3.113, Goddard - data analysis

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - refinement

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links: