BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17682

Title: The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA   PubMed: 21442607

Authors: Spano, Meredith; Walter, Nils

Citation: Spano, Meredith Newby; Walter, Nils. "Solution structure of an alternate conformation of helix27 from Escherichia coli16S rRNA."  Biopolymers 95, 653-668 (2011).

Assembly members:
RNA_(31-MER), polymer, 31 residues, 3775.495 Da.

Natural source:   Common Name: Escherichia coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA_(31-MER): GGGGAGUACGGCCGCAAGGU UAAAACUCCCC

Data sets:
Data typeCount
13C chemical shifts39
15N chemical shifts8
1H chemical shifts157

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (31-MER)1

Entities:

Entity 1, RNA (31-MER) 31 residues - 3775.495 Da.

1   GGGGAGUACG
2   GCCGCAAGGU
3   UAAAACUCCC
4   C

Samples:

sample_2: RNA (31-MER), [U-99% 13C; U-99% 15N], 0.8 – 1.6 mM; H2O 90%; D2O 10%; NaPi 10 mM; EDTA 0.1 mM; NaCl 50 mM

sample_conditions_1: ionic strength: .05 M; pH: 6.4; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMR spectrometers:

  • Varian INOVA 800 MHz
  • Bruker Avance 600 MHz

Related Database Links: