BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17592

Title: Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA   PubMed: 21683709

Authors: Wang, Shenlin; Kim, So Young; Jung, Kwang-Hwan; Ladizhansky, Vladimir; Brown, Leonid

Citation: Wang, Shenlin; Kim, So Young; Jung, Kwang-Hwan; Ladizhansky, Vladimir; Brown, Leonid. "A eukaryotic-like interaction of soluble cyanobacterial sensory rhodopsin transducer with DNA."  J. Mol. Biol. 411, 449-462 (2011).

Assembly members:
ASRT, polymer, 124 residues, Formula weight is not available
DNA, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: Anabaena variabilis   Taxonomy ID: 1172   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Anabaena variabilis

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
ASRT: SLSIGRTCWAIAEGYIPPYG NGPEPQFISHETVCILNAGD EDAHVEITIYYSDKEPVGPY RLTVPARRTKHVRFNDLNDP APIPHDTDFASVIQSNVPIV VQHTRLDSRQAENALLSTIA YANT
DNA: ATGACCTTTAGGAGGAAAGA

Data sets:
Data typeCount
13C chemical shifts306
15N chemical shifts93
1H chemical shifts93

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Anabaena Sensory Rhodopsin Transducer1
2DNA2

Entities:

Entity 1, Anabaena Sensory Rhodopsin Transducer 124 residues - Formula weight is not available

1   SERLEUSERILEGLYARGTHRCYSTRPALA
2   ILEALAGLUGLYTYRILEPROPROTYRGLY
3   ASNGLYPROGLUPROGLNPHEILESERHIS
4   GLUTHRVALCYSILELEUASNALAGLYASP
5   GLUASPALAHISVALGLUILETHRILETYR
6   TYRSERASPLYSGLUPROVALGLYPROTYR
7   ARGLEUTHRVALPROALAARGARGTHRLYS
8   HISVALARGPHEASNASPLEUASNASPPRO
9   ALAPROILEPROHISASPTHRASPPHEALA
10   SERVALILEGLNSERASNVALPROILEVAL
11   VALGLNHISTHRARGLEUASPSERARGGLN
12   ALAGLUASNALALEULEUSERTHRILEALA
13   TYRALAASNTHR

Entity 2, DNA 20 residues - Formula weight is not available

1   DADTDGDADCDCDTDTDTDA
2   DGDGDADGDGDADADADGDA

Samples:

sample_1: ASRT, [U-100% 13C; U-100% 15N; U-50% 2H], 1 mM; H20 90%; D20 10%; Tris 50 mM; NaCl 50 mM

sample_2: ASRT, [U-100% 15N], 1 mM; H20 90%; D20 10%; Tris 50 mM; NaCl 50 mM

sample_conditions_1: ionic strength: 50 mM; pH: 7.2; pressure: 1 atm; temperature: 308 K

sample_conditions_2: ionic strength: 50 mM; pH: 7.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_2isotropicsample_conditions_2
3D HNCOsample_1isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HN(CO)CAsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D HN(CO)CACBsample_1isotropicsample_conditions_1
3D HN(CA)COsample_1isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection, processing

CARA v1.8.4, Keller and Wuthrich - chemical shift assignment, data analysis

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links:

BMRB 17590 17591
PDB
DBJ BAB74865
GB ABA23469
REF WP_010997317