BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17566

Title: 22 nt artificial stemloop TASL1   PubMed: 22252483

Authors: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic

Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets."  J. Biomol. NMR 52, 179-190 (2012).

Assembly members:
TASL1, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
TASL1: GGGAUUCAUUUCGAUGAAUC CC

Data sets:
Data typeCount
13C chemical shifts62
1H chemical shifts71

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TASL1 (monomer)1

Entities:

Entity 1, TASL1 (monomer) 22 residues - Formula weight is not available

1   GGGAUUCAUU
2   UCGAUGAAUC
3   CC

Samples:

sample_1: TASL1 2 mM; D2O 100%

sample_2: TASL1 2 mM; H2O 95%; D2O 5%

sample_conditions_1: pH: 7.4; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection, processing

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: