BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17504

Title: RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide   PubMed: 21642970

Authors: Phan, Anh Tuan; Kuryavyi, Vitaly V; Darnell, Jennifer C; Serganov, Alexander; Majumdar, Ananya; Ilin, Serge; Darnell, Robert B; Patel, Dinshaw J

Citation: Phan, Anh Tuan; Kuryavyi, Vitaly; Darnell, Jennifer; Serganov, Alexander; Majumdar, Ananya; Ilin, Serge; Raslin, Tanya; Polonskaia, Anna; Chen, Cynthia; Clain, David; Darnell, Robert; Patel, Dinshaw. "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction."  Nat. Struct. Mol. Biol. 18, 796-804 (2011).

Assembly members:
RNA_(36-MER), polymer, 36 residues, 11805.102 Da.
entity_2, polymer, 17 residues, 1757.934 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(36-MER): GCUGCGGUGUGGAAGGAGUG GCUGGGUUGCGCAGCG
entity_2: GPRRGDGRRRGGGGRGQ

Data sets:
Data typeCount
1H chemical shifts410

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (36-MER)1
2entity_22

Entities:

Entity 1, RNA (36-MER) 36 residues - 11805.102 Da.

1   GCUGCGGUGU
2   GGAAGGAGUG
3   GCUGGGUUGC
4   GCAGCG

Entity 2, entity_2 17 residues - 1757.934 Da.

1   GLYPROARGARGGLYASPGLYARGARGARG
2   GLYGLYGLYGLYARGGLYGLN

Samples:

sample_1: RNA (36-MER) 1 mM; Peptide 1 mM

sample_2: RNA (36-MER), [U-100% 13C; U-100% 15N], 0.5 mM; Peptide 0.5 mM

sample_3: RNA (36-MER) 0.5 mM; Peptide, [U-100% 13C; U-100% 15N], 0.5 mM

sample_4: RNA (36-MER), [U-100% 13C; U-100% 15N], 0.2-0.5 mM; Peptide, [U-100% 13C; U-100% 15N], 0.2-0.5 mM

sample_5: RNA (36-MER), [U-13C; U-15N]-Gua, 0.5 mM; Peptide 0.5 mM

sample_6: RNA (36-MER), [U-13C; U-15N]-Ade, 0.2 mM; Peptide 0.2 mM

sample_7: RNA (36-MER), [U-13C; U-15N]-Cyt, 0.2 mM; Peptide 0.2 mM

sample_8: RNA (36-MER), [U-13C; U-15N]-Ura, 0.2 mM; Peptide 0.2 mM

sample_9: RNA (36-MER), rG-to-dG and rU-to-dU 2% 15N-labelled, 0.2 mM; Peptide 0.2 mM

sample_conditions_1: ionic strength: 0.050 M; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
JRsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 13C-1H CTHSQCsample_2isotropicsample_conditions_1
HNH-COSYsample_2isotropicsample_conditions_1
HNN-COSYsample_2isotropicsample_conditions_1
HCCH-COSYsample_2isotropicsample_conditions_1
HCCH-TOCSYsample_2isotropicsample_conditions_1
13C-edited NOESYsample_2isotropicsample_conditions_1
15N-edited NOESYsample_2isotropicsample_conditions_1
15N-1H HSQCsample_3isotropicsample_conditions_1
13C-1H HSQCsample_3isotropicsample_conditions_1
HNCAsample_3isotropicsample_conditions_1
HNCOsample_3isotropicsample_conditions_1
HNCOCAsample_3isotropicsample_conditions_1
HNCACBsample_3isotropicsample_conditions_1
HBHACONHsample_3isotropicsample_conditions_1
HCCH-TOCSYsample_3isotropicsample_conditions_1
HCCH-COSYsample_3isotropicsample_conditions_1
13C-edited NOESYsample_3isotropicsample_conditions_1
15N-edited NOESYsample_3isotropicsample_conditions_1
HNN-COSYsample_4isotropicsample_conditions_1
13C-edited NOESYsample_4isotropicsample_conditions_1
15N-edited NOESYsample_4isotropicsample_conditions_1
CTHSQCsample_5isotropicsample_conditions_1
HCCH-COSYsample_5isotropicsample_conditions_1
HCCH-TOCSYsample_5isotropicsample_conditions_1
13C-edited NOESYsample_5isotropicsample_conditions_1
CTHSQCsample_6isotropicsample_conditions_1
HCCH-COSYsample_6isotropicsample_conditions_1
HCCH-TOCSYsample_6isotropicsample_conditions_1
13C-edited NOESYsample_6isotropicsample_conditions_1
CTHSQCsample_7isotropicsample_conditions_1
HCCH-COSYsample_7isotropicsample_conditions_1
HCCH-TOCSYsample_7isotropicsample_conditions_1
13C-edited NOESYsample_7isotropicsample_conditions_1
CTHSQCsample_8isotropicsample_conditions_1
HCCH-COSYsample_8isotropicsample_conditions_1
HCCH-TOCSYsample_8isotropicsample_conditions_1
13C-edited NOESYsample_8isotropicsample_conditions_1
1D 15N-filteredsample_9isotropicsample_conditions_1
2D NOESYsample_9isotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

AMBER, Accelrys Software Inc. - geometry optimization

FELIX, Accelrys Software Inc. - processing

VNMR, Varian - collection

TOPSPIN, Bruker Biospin - collection

CARA, K. Wuthrich - data analysis

NMR spectrometers:

  • Varian Unity 600 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 800 MHz

Related Database Links: