BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17436

Title: Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication   PubMed: 21648432

Authors: Marcheschi, Ryan; Tonelli, Marco; Kumar, Arvind; Butcher, Samuel

Citation: Marcheschi, Ryan; Tonelli, Marco; Kumar, Arvind; Butcher, Samuel. "Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication."  ACS Chem. Biol. 6, 857-864 (2011).

Assembly members:
RNA_(45-MER), polymer, 45 residues, 14519.805 Da.
L94, non-polymer, 336.519 Da.

Natural source:   Common Name: Human immunodeficiency virus   Taxonomy ID: 12721   Superkingdom: not available   Kingdom: virus   Genus/species: Lentivirus not available

Experimental source:   Production method: in vitro transcription   Host organism: E. coli - cell free

Entity Sequences (FASTA):
RNA_(45-MER): GGGAAGAUCUGGCCUUCCCA CAAGGGAAGGCCAGGGAAUC UUCCC

Data sets:
Data typeCount
13C chemical shifts76
1H chemical shifts363

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (45-MER)1
2DB2

Entities:

Entity 1, RNA (45-MER) 45 residues - 14519.805 Da.

1   GGGAAGAUCU
2   GGCCUUCCCA
3   CAAGGGAAGG
4   CCAGGGAAUC
5   UUCCC

Entity 2, DB - C18 H36 N6 - 336.519 Da.

1   L94

Samples:

750_uM_RNA:DB213_H2O: RNA (45-MER) 0.75 mM; DB213 0.75 mM; DSS 20 uM; potassium chloride 20 mM; TRIS, [U-2H], 10 mM; H2O 90%; D2O 10%

750_uM_RNA:DB213_D2O: RNA (45-MER) 0.75 mM; DB213 0.75 mM; DSS 20 uM; potassium chloride 20 mM; TRIS, [U-2H], 10 mM; D2O 100%

1.5_mM_RNA:DB213_D2O: RNA (45-MER) 1.5 mM; DB213 1.5 mM; DSS 40 uM; potassium chloride 40 mM; TRIS, [U-2H], 20 mM; D2O 100%

1.5_mM_RNA:DB213_Pf1_D2O: RNA (45-MER) 1.5 mM; DB213 1.5 mM; DSS 40 uM; potassium chloride 40 mM; TRIS, [U-2H], 20 mM; Pf1 phage 4.5 mg; D2O 100%

H2O_samples: ionic strength: 20 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

D2O_samples: ionic strength: 20 mM; pH: 7.0; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESY750_uM_RNA:DB213_H2OisotropicH2O_samples
2D 1H-1H NOESY750_uM_RNA:DB213_D2OisotropicD2O_samples
2D 1H-1H TOCSY750_uM_RNA:DB213_D2OisotropicD2O_samples
2D 1H-13C HSQC1.5_mM_RNA:DB213_D2OisotropicD2O_samples
2D 1H-13C HSQC1.5_mM_RNA:DB213_Pf1_D2OanisotropicD2O_samples

Software:

HADDOCK v2.0, Alexandre Bonvin, Utrecht University - docking, refinement, structure solution

AMBER v9.0, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement, structure solution

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

SYBYL v8.0, Tripos - data analysis, geometry optimization

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

xwinnmr v3.5, Bruker Biospin - collection, processing

VNMRJ, Varian - collection

PALES, Markus Zweckstetter, Ad Bax - data analysis

PyMol, DeLano Scientific - data analysis

NMR spectrometers:

  • Bruker DMX 750 MHz
  • Varian Avance 900 MHz

Related Database Links: