BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17408

Title: Chemical probe bound to HIV TAR RNA   PubMed: 21763501

Authors: Davidson, Amy; Begley, Darren; Lau, Carmen; Varani, Gabriele

Citation: Davidson, Amy; Begley, Darren; Lau, Carmen; Varani, Gabriele. "A small-molecule probe induces a conformation in HIV TAR RNA capable of binding drug-like fragments"  J. Mol. Biol. 410, 984-996 (2011).

Assembly members:
HIV_TAR_RNA, polymer, 29 residues, 132.116 Da.
ARG, non-polymer, 175.209 Da.
L8H, non-polymer, 173.211 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
HIV_TAR_RNA: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC

Data sets:
Data typeCount
1H chemical shifts177

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1HIV TAR RNA1
2ARGININE2
34-METHOXYNAPHTHALEN-2-AMINE3

Entities:

Entity 1, HIV TAR RNA 29 residues - 132.116 Da.

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Entity 2, ARGININE - C6 H15 N4 O2 - 175.209 Da.

1   ARG

Entity 3, 4-METHOXYNAPHTHALEN-2-AMINE - C11 H11 N O - 173.211 Da.

1   L8H

Samples:

sample_1: HIV TAR RNA 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM

sample_2: HIV TAR RNA 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM

sample_3: HIV TAR RNA, [U-100% 13C; U-100% 15N], 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM

sample_conditions_2: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 277 K

sample_conditions_1: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H-1H NOESYsample_1isotropicsample_conditions_1
1H-1H NOESY with WATERGATEsample_2isotropicsample_conditions_2
1H-1H TOCSYsample_1isotropicsample_conditions_1
HCCH-COSYsample_3isotropicsample_conditions_1
13C HSQC-NOESYsample_3isotropicsample_conditions_1

Software:

X-PLOR, Brunger A. T. et.al. - refinement

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DMX 600 MHz

Related Database Links: