BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17339

Title: The Solution Structure of a Fungal AREA Protein-DNA Complex: An Alternative Binding Mode for a Basic Carboxyl Tail of GATA factors   PubMed: 9533883

Authors: Starich, Mary; Wikstrom, Mats; Arst, Herbert; Clore, G.; Gronenborn, Angela

Citation: Starich, Mary; Wikstrom, Mats; Arst, Herbert; Clore, G.; Gronenborn, Angela. "The solution structure of a fungal AREA protein-DNA complex: an alternative binding mode for the basic carboxyl tail of GATA factors."  J. Mol. Biol. 277, 605-620 (1998).

Assembly members:
AREA, polymer, 66 residues, Formula weight is not available
GATA, polymer, 26 residues, Formula weight is not available

Natural source:   Common Name: Aspergillus nidulans   Taxonomy ID: 162425   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Aspergillus nidulans

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
AREA: MKNGEQNGPTTCTNCFTQTT PLWRRNPEGQPLCNACGLFL KLHGVVRPLSLKTDVIKKRN RNSANS
GATA: CAGCGATAGAGACGTCGCTA TCTCTG

Data sets:
Data typeCount
kinetic rates1
binding constants6

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1AREA1
2GATA2

Entities:

Entity 1, AREA 66 residues - Formula weight is not available

1   METLYSASNGLYGLUGLNASNGLYPROTHR
2   THRCYSTHRASNCYSPHETHRGLNTHRTHR
3   PROLEUTRPARGARGASNPROGLUGLYGLN
4   PROLEUCYSASNALACYSGLYLEUPHELEU
5   LYSLEUHISGLYVALVALARGPROLEUSER
6   LEULYSTHRASPVALILELYSLYSARGASN
7   ARGASNSERALAASNSER

Entity 2, GATA 26 residues - Formula weight is not available

1   DCDADGDCDGDADTDADGDA
2   DGDADCDGDTDCDGDCDTDA
3   DTDCDTDCDTDG

Samples:

sample_1: AREA, [U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; H2O 90%; D2O 10%

sample_2: AREA, [U-13C; U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; H2O 90%; D2O 10%

sample_3: AREA, [U-13C; U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; D2O 99.996%

sample_conditions_1: temperature: 298 K; pH: 6.5; pressure: 1 atm

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1

Software:

NMRPipe, Johnson, One Moon Scientific - processing

PIPP, Garrett - data analysis

CAPP, Garrett - data analysis

STAPP, (Garrett et al., 1991) - data analysis

NMR spectrometers:

  • Bruker AMX 500 MHz
  • Bruker DMX 500 MHz
  • Bruker AMX 600 MHz
  • Bruker DMX 600 MHz
  • Bruker DMX 750 MHz
  • Bruker AMX 360 MHz

Related Database Links:

PDB
DBJ GAN02876
EMBL CAA36731
GB AAU05980 AEO65119 EAA60701 EAW08915 EGS22804
REF XP_001270341 XP_003651455 XP_006691796 XP_681936
SP P17429
TPE CBF78221