BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17326

Title: Shin-Dalgarno sequence of the hcnA gene of Pseudomonas fluourescens   PubMed: 22252483

Authors: Schubert, Mario; Allain, Frederic; Aeschbacher, Thomas

Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets."  J. Biomol. NMR 52, 179-190 (2012).

Assembly members:
RP1, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: Pseudomonas fluorescens   Taxonomy ID: 294   Superkingdom: bacteria   Kingdom: not available   Genus/species: Pseudomonas fluorescens

Experimental source:   Production method: in vitro transcription   Host organism: in vitro

Entity Sequences (FASTA):
RP1: GGGCUUCACGGAUGAAGCCC

Data sets:
Data typeCount
13C chemical shifts54
1H chemical shifts60

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RP11

Entities:

Entity 1, RP1 20 residues - Formula weight is not available

nucleotides 1-4 and 17-20 are articifical G-C base pairs to stabilize the stem

1   GGGCUUCACG
2   GAUGAAGCCC

Samples:

sample_1: RP1 1.3 ± 0.1 mM; H2O 100%

sample_conditions_1: ionic strength: 0 M; pH: 7.4; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

SPARKY v3.114, Goddard - chemical shift assignment

TOPSPIN v2.1, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 500 MHz

Related Database Links: