BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17316

Title: Specifier domain and GA motif region of B. subtilis tyrS T box leader RNA   PubMed: 21333656

Authors: Wang, Jiachen

Citation: Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of the K-Turn and Specifier Loop Domains from the Bacillus subtilis tyrS T-Box Leader RNA."  J. Mol. Biol. 408, 99-117 (2011).

Assembly members:
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA, polymer, 55 residues, 244.204 Da.

Natural source:   Common Name: firmicutes   Taxonomy ID: 1423   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Bacillus subtilis

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA: GGGAGUAAAGAUUGAGACAA GUAGGACUUCGGUCCGAAUA CACUCAUGAACUCCC

Data sets:
Data typeCount
13C chemical shifts347
15N chemical shifts18
1H chemical shifts408

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1hairpin 11

Entities:

Entity 1, hairpin 1 55 residues - 244.204 Da.

1   GGGAGUAAAG
2   AUUGAGACAA
3   GUAGGACUUC
4   GGUCCGAAUA
5   CACUCAUGAA
6   CUCCC

Samples:

sample_1: Specifier Domain and GA motif region of B. subtilis tyrS T box leader RNA, [U-100% 13C; U-100% 15N], 1 mM; D2O 100%

sample_2: Specifier Domain and GA motif region of B. subtilis tyrS T box leader RNA, [U-100% 13C; U-100% 15N], 1 mM; D2O 10%; H2O 90%

sample_conditions_1: pH: 6.8; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
3D 1H-15N NOESYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2orientedsample_conditions_1
3D HCCH-COSYsample_1isotropicsample_conditions_1
3D HCNsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C ct-spin-echo differencesample_1isotropicsample_conditions_1

Software:

VNMRJ, Varian - collection

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: