BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17292

Title: NMR structure of the A730 loop of the Neurospora VS ribozyme   PubMed: 21266483

Authors: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale

Citation: Desjardins, Genevieve; Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jerome; Legault, Pascale. "NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site."  Nucleic Acids Res. 39, 4427-4437 (2011).

Assembly members:
VS_ribozyme_SVI_RNA_(26-MER), polymer, 26 residues, 8421.162 Da.

Natural source:   Common Name: Neurospora   Taxonomy ID: 5140   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora not available

Experimental source:   Production method: enzymatic synthesis

Entity Sequences (FASTA):
VS_ribozyme_SVI_RNA_(26-MER): GAGCUGCAGCACGAAAGUGA CGGCUC

Data sets:
Data typeCount
13C chemical shifts173
15N chemical shifts91
1H chemical shifts232

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (26-MER)1

Entities:

Entity 1, RNA (26-MER) 26 residues - 8421.162 Da.

1   GAGCUGCAGC
2   ACGAAAGUGA
3   CGGCUC

Samples:

sample_1: VS ribozyme SVI RNA (26-MER)0.4 – 1.8 mM; H2O 90%; D2O 10%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_2: VS ribozyme SVI RNA (26-MER)0.4 – 1.8 mM; D2O 100%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_3: VS ribozyme SVI RNA (26-MER), [U-15N], 0.4 – 1.8 mM; H2O 90%; D2O 10%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_4: VS ribozyme SVI RNA (26-MER), [U-15N], 0.4 – 1.8 mM; D2O 100%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_5: VS ribozyme SVI RNA (26-MER), [U-13C; U-15N], 0.4 – 1.8 mM; H2O 90%; D2O 10%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_6: VS ribozyme SVI RNA (26-MER), [U-13C; U-15N], 0.4 – 1.8 mM; D2O 100%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM

sample_7: VS ribozyme SVI RNA (26-MER), [U-15N], 0.4 ± 0.1 mM; H2O 90%; D2O 10%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM; Pf1 filamentous phage 17 mg/mL

sample_8: VS ribozyme SVI RNA (26-MER), [U-13C; U-15N], 0.4 ± 0.1 mM; D2O 100%; sodium cacodylate 10 mM; KCl 50 mM; NaN3 0.05 mM; MgCl2 5 mM; Pf1 filamentous phage 17 mg/mL

sample_conditions_1: ionic strength: 55 mM; pH: 6.5; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 55 mM; pH: 6.5; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C CT-HSQCsample_6isotropicsample_conditions_2
2D 1H-13C HMQCsample_6isotropicsample_conditions_2
2D 1H-15N MQ-(HC)N(C)Hsample_6isotropicsample_conditions_2
3D CT-HCCH-COSYsample_6isotropicsample_conditions_2
3D HCCH-TOCSYsample_6isotropicsample_conditions_2
3D 13C-edited HMQC-NOESYsample_6isotropicsample_conditions_2
1D flip-back watergate 1Hsample_1isotropicsample_conditions_1
2D flip-back watergate NOESYsample_1isotropicsample_conditions_1
2D imino- and amino-optimized 2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D H(NCCC)H for uracil and cytosine residuessample_5isotropicsample_conditions_1
2D H(NC)-TOCSY-(C)H for guanosine residuessample_5isotropicsample_conditions_1
2D (H)N(C)-TOCSY-(C)H for adenosine residuessample_5isotropicsample_conditions_1
2D 1H-15N CPMG-NOESYsample_3isotropicsample_conditions_1
2D 1H 15N HMQC optimized for transfers via J=7.0 Hz and J=21 Hzsample_4isotropicsample_conditions_2
2D HNN-COSYsample_3isotropicsample_conditions_1
2D DQF COSYsample_2isotropicsample_conditions_2
3D HCCH-E.COSYsample_6isotropicsample_conditions_2
2D imino-optimized 2D 1H-15N HSQCsample_7anisotropicsample_conditions_1
Spin-state selective experimentssample_8isotropicsample_conditions_2
Spin-state selective experimentssample_6anisotropicsample_conditions_2

Software:

Module v1.0, (Module) - data analysis

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, peak picking

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

CURVES, (CURVES) Lavery, R., Moakher, M., Maddocks, J.H., Petkeviciute, D. and Zakrzewska, K. - structure analysis

PyMol, PyMol (Schr dinger) - structure analysis, structure display

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: