BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17222

Title: lac repressor-lac operator interaction: NMR observations   PubMed: 7043455

Authors: Nick, Harry; Arndt, Kim; Boschelli, Frank; Jarema, Mary Ann; Lillis, Marcella; Sadler, John; Caruthers, Marvin; Lu, Ponzy

Citation: Nick, Harry; Arndt, Kim; Boschelli, Frank; Jarema, Mary Ann; Lillis, Marcella; Sadler, John; Caruthers, Marvin; Lu, Ponzy. "lac repressor-lac operator interaction: NMR observations"  Proc. Natl. Acad. Sci. U.S.A. 79, 218-222 (1982).

Assembly members:
operator, polymer, 73 residues, Formula weight is not available
repressor, polymer, 7 residues, Formula weight is not available

Natural source:   Common Name: cattle   Taxonomy ID: 9913   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Bos taurus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
operator: CCACATGTGGAATTGTGAGC GGATAACAATTTGTGGGGTG TACACCTTAACACTCGCCTA TTGTTAAACACC
repressor: MXXXHYL

Data sets:
  • assigned_chemical_shifts
  • chemical rates
Data typeCount
binding constants9
kinetic rates1

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1operator1
2repressor2

Entities:

Entity 1, operator 73 residues - Formula weight is not available

1   DCDCDADCDADTDGDTDGDG
2   DADADTDTDGDTDGDADGDC
3   DGDGDADTDADADCDADADT
4   DTDTDGDTDGDGDGDGDTDG
5   DTDADCDADCDCDTDTDADA
6   DCDADCDTDCDGDCDCDTDA
7   DTDTDGDTDTDADADADCDA
8   DCDC

Entity 2, repressor 7 residues - Formula weight is not available

X=YOF

1   METYOFYOFYOFHISTYRLEU

Samples:

sample_1: operator0 – 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.2 M; EDTA 1 mM; dithiothreitol 1 mM; H2O 75%; D2O 25%

sample_2: operator0 – 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.5 M; EDTA 1 mM; dithiothreitol 1 mM; H2O 75%; D2O 25%

sample_3: operator0 – 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.5 M; EDTA 1 mM; dithiothreitol 1 mM; iPrSGal 0.0012 mM; H2O 75%; D2O 25%

sample_conditions_1: pH: 7.4; pressure: 1 atm; temperature: 295 K

Experiments:

NameSampleSample stateSample conditions
19F NMRsample_1isotropicsample_conditions_1
19F NMRsample_2isotropicsample_conditions_1
19F NMRsample_3isotropicsample_conditions_1

Software:

software, na - na

NMR spectrometers:

  • Nicolet NT 141.2 MHz

Related Database Links: