BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17188

Title: Solution structure of P2a-J2a/b-P2b of human telomerase RNA   PubMed: 20966348

Authors: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli

Citation: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli. "Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA."  Proc. Natl. Acad. Sci. U.S.A. 107, 18761-18768 (2010).

Assembly members:
RNA_35-MER, polymer, 35 residues, 11164.710 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: reverse transcriptase

Entity Sequences (FASTA):
RNA_35-MER: GGCUUUUGCUCCCCGUGCUU CGGCACGGAAAAGCC

Data sets:
Data typeCount
13C chemical shifts235
15N chemical shifts61
1H chemical shifts309

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (35-MER)1

Entities:

Entity 1, RNA (35-MER) 35 residues - 11164.710 Da.

1   GGCUUUUGCU
2   CCCCGUGCUU
3   CGGCACGGAA
4   AAGCC

Samples:

1_Un_H2O: RNA_35-MER 1.0 mM; H2O 90%; D2O 10%

2_F_H2O: P2ab RNA (35-MER), [U-98% 13C; U-98% 15N], 1.0 mM; H2O 90%; D2O 10%

3_A_D2O: P2ab RNA (35-MER), [U-13C; U-15N]-Ade, 1.0 mM; D2O 100%

4_C_D2O: P2ab RNA (35-MER), [U-13C; U-15N]-Cyt, 1.0 mM; D2O 100%

5_G_D2O: P2ab RNA (35-MER), [U-13C; U-15N]-Gua, 1.0 mM; D2O 100%

6_U_D2O: P2ab RNA (35-MER), [U-13C; U-15N]-Ura, 1.0 mM; D2O 100%

7_Un_D2O: P2ab RNA (35-MER) 1.0 mM; D2O 100%

8_F_D2O: P2ab RNA (35-MER), [U-98% 13C; U-98% 15N], 1.0 mM; D2O 100%

10C: ionic strength: 100 mM; pH: 6.4; pressure: 1 atm; temperature: 283.15 K

20C: ionic strength: 100 mM; pH: 6.4; pressure: 1 atm; temperature: 293.15 K

Experiments:

NameSampleSample stateSample conditions
2D 11echo NOESY1_Un_H2Oisotropic10C
2D Watergate NOESY1_Un_H2Oisotropic10C
2D 1H-1H NOESY7_Un_D2Oisotropic20C
2D 1H-1H TOCSY7_Un_D2Oisotropic20C
2D 1H-15N HSQC2_F_H2Oisotropic10C
2D 1H-15N HSQC2_F_H2Oisotropic20C
2D 1H-13C HSQC2_F_H2Oisotropic20C
2D 13C Filtered/Edited NOESY3_A_D2Oisotropic20C
2D 13C Filtered/Edited NOESY4_C_D2Oisotropic20C
2D 13C Filtered/Edited NOESY5_G_D2Oisotropic20C
2D 13C Filtered/Edited NOESY6_U_D2Oisotropic20C
2D HCCH-COSY3_A_D2Oisotropic20C
2D HCCH-COSY4_C_D2Oisotropic20C
2D HCCH-COSY5_G_D2Oisotropic20C
2D HCCH-COSY6_U_D2Oisotropic20C
3D HCCH-TOCSY3_A_D2Oisotropic20C
3D HCCH-TOCSY4_C_D2Oisotropic20C
3D HCCH-TOCSY5_G_D2Oisotropic20C
3D HCCH-TOCSY6_U_D2Oisotropic20C
2D 1H-13C HSQC3_A_D2Oisotropic20C
2D 1H-13C HSQC4_C_D2Oisotropic20C
2D 1H-13C HSQC5_G_D2Oisotropic20C
2D 1H-13C HSQC6_U_D2Oisotropic20C
2D 31P Spin echo difference CT-HSQC3_A_D2Oisotropic20C
2D 31P Spin echo difference CT-HSQC4_C_D2Oisotropic20C
2D 31P Spin echo difference CT-HSQC5_G_D2Oisotropic20C
2D 31P Spin echo difference CT-HSQC6_U_D2Oisotropic20C
2D 31P Spin echo difference CT-HCCH correlation3_A_D2Oisotropic20C
2D 31P Spin echo difference CT-HCCH correlation4_C_D2Oisotropic20C
2D 31P Spin echo difference CT-HCCH correlation5_G_D2Oisotropic20C
2D 31P Spin echo difference CT-HCCH correlation6_U_D2Oisotropic20C
2D 1H-13C HSQC8_F_D2Oisotropic20C
2D 1H-15N HSQC2_F_H2Oanisotropic20C
2D 1H-13C S3CT-HSQC2_F_H2Oanisotropic20C
2D 1H-13C S3CT-HSQC2_F_H2Oisotropic20C
2D HNNOESY2_F_H2Oisotropic10C
3D HCNCH3_A_D2Oisotropic20C
3D HCNCH4_C_D2Oisotropic20C
3D HCNCH5_G_D2Oisotropic20C
3D HCNCH6_U_D2Oisotropic20C

Software:

X-PLOR NIH v2.9.8, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

SPARKY v3.110., Goddard - chemical shift assignment, data analysis, processing

xwinnmr, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DRX 500 MHz
  • Bruker DRX 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: