BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17130

Title: Zif 268 with 12bp DNA   PubMed: 20718505

Authors: Takayama, Yuki; Sahu, Debashish

Citation: Takayama, Yuki; Sahu, Debashish; Iwahara, Junji. "NMR studies of translocation of the Zif268 protein between its target DNA Sites."  Biochemistry 49, 7998-8005 (2010).

Assembly members:
zif268, polymer, 90 residues, Formula weight is not available
12bp_DNA, polymer, 24 residues, Formula weight is not available
ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: house mouse   Taxonomy ID: 10090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Mus musculus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
zif268: PERPYACPVESCDRRFSRSD ELTRHIRIHTGQKPFQCRIC MRNFSRSDHLTTHIRTHTGE KPFACDICGRKFARSDERKR HTKIHLRQKD
12bp_DNA: AGCGTGGGCGTATACGCCCA CGCA

Data sets:
Data typeCount
13C chemical shifts175
15N chemical shifts82
1H chemical shifts82

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1zif2681
2zinc13
3zinc23
4zinc33
512bp DNA2

Entities:

Entity 1, zif268 90 residues - Formula weight is not available

zinc finger domains, amino acids 333-421 from the egr1 sequence (uniprot ID: P08046)

1   PROGLUARGPROTYRALACYSPROVALGLU
2   SERCYSASPARGARGPHESERARGSERASP
3   GLULEUTHRARGHISILEARGILEHISTHR
4   GLYGLNLYSPROPHEGLNCYSARGILECYS
5   METARGASNPHESERARGSERASPHISLEU
6   THRTHRHISILEARGTHRHISTHRGLYGLU
7   LYSPROPHEALACYSASPILECYSGLYARG
8   LYSPHEALAARGSERASPGLUARGLYSARG
9   HISTHRLYSILEHISLEUARGGLNLYSASP

Entity 3, zinc1 - Zn - 65.409 Da.

1   ZN

Entity 2, 12bp DNA 24 residues - Formula weight is not available

1   DADGDCDGDTDGDGDGDCDG
2   DTDADTDADCDGDCDCDCDA
3   DCDGDCDA

Samples:

sample_1: TRIS 10 mM; potassium chloride 20 mM; zif268, [U-13C; U-15N], 1 mM; 12bp DNA 1.2 mM; H2O 93%; D2O 7%

sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
3D HNCACOsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HN(CO)CAsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D C(CO)NHsample_1isotropicsample_conditions_1
3D H(CACO)NHsample_1isotropicsample_conditions_1
15N Edited NOESY-HSQCsample_1isotropicsample_conditions_1

Software:

NMRView, Johnson, One Moon Scientific - chemical shift assignment

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian Uniform NMR System 800 MHz

Related Database Links:

PDB
DBJ BAC29885 BAC30748 BAE21758 BAE26289 BAE27077
EMBL CAA36777 CAB46678 CAB60137 CAG31294 CDQ66955
GB AAA35815 AAA37544 AAA39382 AAA40416 AAA60740
REF NP_001039340 NP_001074426 NP_001083862 NP_001084566 NP_001090830
SP A4II20 O73691 O73692 O73693 P08046
TPG DAA27412