BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17106

Title: solution structure of a preQ1 riboswitch (Class I) aptamer bound to preQ1   PubMed: 19285444

Authors: Kang, Mijeong; Zhang, Qi; Feigon, Juli

Citation: Kang, Mijeong; Zhang, Qi; Peterson, Robert; Feigon, Juli. "Structural Insights into Riboswitch Control of the Biosynthesis of Queuosine, a Modified Nucleotide Found in the Anticodon of tRNA"  Mol. Cell 33, 784-790 (2009).

Assembly members:
RNA_(36-MER), polymer, 36 residues, 11527.992 Da.
PRF, non-polymer, 179.179 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(36-MER): GGAGAGGUUCUAGUUAUACC CUCUAUAAAAAACUAA

Data sets:
Data typeCount
13C chemical shifts229
15N chemical shifts67
1H chemical shifts319

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (36-MER)1
27-DEAZA-7-AMINOMETHYL-GUANINE2

Entities:

Entity 1, RNA (36-MER) 36 residues - 11527.992 Da.

1   GGAGAGGUUC
2   UAGUUAUACC
3   CUCUAUAAAA
4   AACUAA

Entity 2, 7-DEAZA-7-AMINOMETHYL-GUANINE - C7 H9 N5 O - 179.179 Da.

1   PRF

Samples:

sample_1: preQ1-RNA 36mer, [U-13C; U-15N]-Cyt, 1 mM; D2O 100%; KCl 50 mM

sample_2: preQ1-RNA 36mer 1 mM; H2O 90%; D2O 10%; KCl 50 mM

sample_3: preQ1-RNA 36mer, [U-13C; U-15N], 0.7 mM; H2O 90%; D2O 10%; KCl 50 mM

sample_4: preQ1-RNA 36mer, [U-13C; U-15N]-Ade, 1 mM; D2O 100%; KCl 50 mM

sample_5: preQ1-RNA 36mer, [U-13C; U-15N]-Gua, 1 mM; D2O 100%; KCl 50 mM

sample_6: preQ1-RNA 36mer, [U-13C; U-15N]-Ura, 1 mM; D2O 100%; KCl 50 mM

sample_7: preQ1-RNA 36mer, U-H5,3',4',5',5''-2H, 1 mM; D2O 100%; KCl 50 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.3; pressure: 1 atm; temperature: 300 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-15N COSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1

Software:

xwinnmr, Varian - collection, processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DRX 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: