BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17083

Title: Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography   PubMed: 20933521

Authors: Summers, Michael; Irobalieva, Rossitza; Tolbert, Blanton; Smalls-Manty, Adjoa; Iyalla, Kilali; Loeliger, Kelsey; D'Souza, Victoria; Khant, Htet; Schmid, Michael; Garcia, Eric; Telesnitsky, Alice; Chiu, Wah; Miyazaki, Yasuyuki

Citation: Miyazaki, Yasuyuki; Irobalieva, Rossitza; Tolbert, Blanton; Smalls-Mantey, Adjoa; Iyalla, Kilali; Loeliger, Kelsey; Khant, Victoria; Schmid, Htet; Garcia, Michael; Telesnitsky, Eric; Chiu, Alice; Summers, Wah. "Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography."  J. Mol. Biol. 404, 751-772 (2010).

Assembly members:
RNA_(65-MER), polymer, 65 residues, 21071.766 Da.
RNA_(66-MER), polymer, 66 residues, 21416.973 Da.

Natural source:   Common Name: Moloney Murine Leukemia Virus   Taxonomy ID: 11801   Superkingdom: Virus   Kingdom: not available   Genus/species: Gammaretrovirus not available

Experimental source:   Production method: recombinant technology   Host organism: Moloney Murine Leukemia Virus

Entity Sequences (FASTA):
RNA_(65-MER): GGCGGACCCGUGGUGGAACA GACGUGUUCGGAACACCCGG CCGCAACCCUGGGAGACGUC CCAGG
RNA_(66-MER): GGCGGACCCGUGGUGGAACA GACGUGUUCGGAACACCCGG CCGCAACCCUGGGAGACGUC CCAGGG

Data sets:
Data typeCount
1H chemical shifts208

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (65-MER)1
2RNA (66-MER)2

Entities:

Entity 1, RNA (65-MER) 65 residues - 21071.766 Da.

1   GGCGGACCCG
2   UGGUGGAACA
3   GACGUGUUCG
4   GAACACCCGG
5   CCGCAACCCU
6   GGGAGACGUC
7   CCAGG

Entity 2, RNA (66-MER) 66 residues - 21416.973 Da.

1   GGCGGACCCG
2   UGGUGGAACA
3   GACGUGUUCG
4   GAACACCCGG
5   CCGCAACCCU
6   GGGAGACGUC
7   CCAGGG

Samples:

sample_1: RNA (65-MER), [U-2H], 400 – 800 uM; D2O 100 ± 100 %

sample_conditions_1: ionic strength: 80 mM; pH: 7.0; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1isotropicsample_conditions_1
2D NOESYsample_1isotropicsample_conditions_1

Software:

CYANA v2.1, Guntert, Mumenthaler and Wuthrich - structure solution

NMR spectrometers:

  • Bruker DRX 800 MHz
  • Bruker DRX 600 MHz

Related Database Links: