BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16980

Title: RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width   PubMed: 20549304

Authors: Tolbert, Blanton; Summers, Michael; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Stark, Patrice; Singh, Rashmi; Bax, Ad; Case, David

Citation: Tolbert, Blanton; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Starck, Patrice; Singh, Rashmi; Bax, Ad; Case, David; Summers, Michael. "Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement."  J. Biomol. NMR 47, 205-219 (2010).

Assembly members:
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), polymer, 29 residues, Formula weight is not available

Natural source:   Common Name: Murine leukemia virus   Taxonomy ID: 11786   Superkingdom: not available   Kingdom: not available   Genus/species: Gammaretrovirus not available

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'): GCGGUACUAGUUAGCUAACU AGCUUUGUA

Data sets:
Data typeCount
1H chemical shifts77

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all