BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16941

Title: Recognition of HIV TAR RNA by peptide mimetic of Tat protein   PubMed: 20724442

Authors: Davidson, Amy; Patora-Komisarska, Krystyna; Robinson, John; Varani, Gabriele

Citation: Davidson, Amy; Patora-Komisarska, Krystyna; Robinson, John; Varani, Gabriele. "Essential structural requirements for specific recognition of HIV TAR RNA by peptide mimetics of Tat protein."  Nucleic Acids Res. 39, 248-256 (2011).

Assembly members:
HIV-1_TAR/KP-Z-41, polymer, 29 residues, 11193.474 Da.
peptide, polymer, 18 residues, Formula weight is not available

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: virus   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: in vitro transcription

Entity Sequences (FASTA):
HIV-1_TAR/KP-Z-41: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC
peptide: RVRCRQRKGRRICIRIXP

Data sets:
Data typeCount
1H chemical shifts275

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA/RNA (47-MER)1
2peptide2

Entities:

Entity 1, DNA/RNA (47-MER) 29 residues - 11193.474 Da.

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Entity 2, peptide 18 residues - Formula weight is not available

1   ARGVALARGCYSARGGLNARGLYSGLYARG
2   ARGILECYSILEARGILEDPRPRO

Samples:

sample_1: HIV-1 TAR/KP-Z-41 1 mM; D2O 100%

sample_2: HIV-1 TAR/KP-Z-41 1 mM; H2O 90%; D2O 10%

sample_3: HIV-1 TAR/KP-Z-41, [U-98% 13C; U-98% 15N], 1 mM; D2O 100%

sample_4: HIV-1 TAR/KP-Z-41, [U-2H], 1 mM; D2O 100%

sample_5: HIV-1 TAR/KP-Z-41, [U-98% 13C; U-98% 15N], 1 mM; H2O 90%; D2O 10%

sample_conditions_2: ionic strength: 0.01 M; pH: 6.6; pressure: 1 atm; temperature: 277 K

sample_conditions_1: ionic strength: 0.01 M; pH: 6.6; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_3isotropicsample_conditions_1
3D 1H-13C NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
2D F1fF2f NOESYsample_3isotropicsample_conditions_1
2D F1fF2f NOESYsample_5isotropicsample_conditions_2
2D F1fF2f TOCSYsample_3isotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure solution

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DMX 600 MHz

Related Database Links:

PDB