BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16877

Title: Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein   PubMed: 19584251

Authors: Davidson, Amy; Leeper, Thomas; Varani, Gabriele

Citation: Davidson, Amy; Leeper, Thomas; Athanassiou, Zafiria; Patora-Komisarska, Krystyna; Karn, Jonathan; Robinson, John; Varani, Gabriele. "Simultaneous recognition of HIV-1 TAR RNA bulge and loop sequences by cyclic peptide mimics of Tat protein."  Proc. Natl. Acad. Sci. U.S.A. 106, 11931-11936 (2009).

Assembly members:
TAR, polymer, 29 residues, Formula weight is not available
TAT, polymer, 14 residues, Formula weight is not available

Natural source:   Common Name: AIDS virus   Taxonomy ID: 12721   Superkingdom: Virus   Kingdom: not available   Genus/species: Lentivirus not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
TAR: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC
TAT: RVRTRKGRRIRIPP

Data sets:
Data typeCount
1H chemical shifts330

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TAR RNA bulge1
2Tat protein2

Entities:

Entity 1, TAR RNA bulge 29 residues - Formula weight is not available

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Entity 2, Tat protein 14 residues - Formula weight is not available

1   ARGVALARGTHRARGLYSGLYARGARGILE
2   ARGILEPROPRO

Samples:

sample_1: HIV-1 TAR RNA 1.0 ± 0.1 mM; L-22 peptide 1.0 ± 0.2 mM; D2O 100%; potassium phosphate 10 mM

sample_2: HIV-1 TAR RNA 1.0 ± 0.1 mM; L-22 peptide 1.0 ± 0.2 mM; D2O 10%; potassium phosphate 10 mM; H2O 90%

sample_3: HIV-1 TAR RNA, [U-98% 13C; U-98% 15N], 1.0 ± 0.1 mM; L-22 peptide 1.0 ± 0.2 mM; D2O 100%; potassium phosphate 10 mM

sample_4: HIV-1 TAR RNA, [U-98% 13C; U-98% 15N], 1.0 ± 0.1 mM; L-22 peptide 1.0 ± 0.2 mM; D2O 10%; potassium phosphate 10 mM; H2O 90%

sample_5: HIV-1 TAR RNA, [U-2H], 1.0 ± 0.2 mM; L-22 peptide 1.0 ± 0.2 mM; D2O 100%; potassium phosphate 10 mM

sample_conditions_1: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 277 K

Experiments:

NameSampleSample stateSample conditions
3D-13C HMQC NOESYsample_3isotropicsample_conditions_1
3D HCCH TOCSYsample_3isotropicsample_conditions_1
IPAP-HSQCsample_3isotropicsample_conditions_1
15N HSQCsample_4isotropicsample_conditions_2
2D noesysample_1isotropicsample_conditions_1
2D watergate NOESYsample_2isotropicsample_conditions_2
F1fF2f-type noesysample_3isotropicsample_conditions_1
F1fF2f-type tocsysample_3isotropicsample_conditions_1
2D HCCH-COSYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
F1fF2f-type watergate noesysample_4isotropicsample_conditions_2

Software:

X-PLOR NIH v2.16.0, C.D. Schwieters, J.J. Kuszewski, N. Tjandra and G.M. Clore - structure solution

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

TOPSPIN, Bruker Biospin - collection

TALOS, Cornilescu, Delaglio and Bax - data analysis

SPARKY, Goddard - peak picking

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DMX 600 MHz
  • Varian Inova 800 MHz
  • Bruker AVIII 600 MHz

Related Database Links: