BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16852

Title: Solution structure of a fully modified 2'-F/2'-OMe siRNA construct   PubMed: 20624819

Authors: Podbevsek, Peter; Bhat, Balkrishen; Plavec, Janez

Citation: Podbevsek, Peter; Allerson, Charles; Bhat, Balkrishen; Plavec, Janez. "Solution-state structure of a fully alternately 2'-F/2'-OMe modified 42-nt dimeric siRNA construct."  Nucleic Acids Res. 38, 7298-7307 (2010).

Assembly members:
ISIS401156, polymer, 21 residues, Formula weight is not available
ISIS401157, polymer, 21 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
ISIS401156: XXXXXXXXXXXXXXXXXXXX X
ISIS401157: XXXXXXXXXXXXXXXXXXXX X

Data sets:
  • assigned_chemical_shifts
Data typeCount
1H chemical shifts231

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1ISIS4011561
2ISIS4011572

Entities:

Entity 1, ISIS401156 21 residues - Formula weight is not available

Fully 2' modified GGGUAAAUACAUUCUUCAUUU

1   FGMGFGMUFOLMAFOLMUFOLMC
2   FOLMUFUMCFUMUFCMAFUMU
3   FU

Entity 2, ISIS401157 21 residues - Formula weight is not available

Fully 2' modified AUGAAGAAUGUAUUUACCCUU

1   MAFUMGFOLMAFGMAFOLMUFG
2   MUFOLMUFUMUFOLMCFCMCFU
3   MU

Samples:

ISIS_D2O: ISIS401156 2 mM; ISIS401157 2 mM; D2O 100%; NaCl 20 mM; sodium phosphate 20 mM

ISIS_H2O: ISIS401156 2 mM; ISIS401157 2 mM; H2O 100%; NaCl 20 mM; sodium phosphate 20 mM

RT: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

5C: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D DQF-COSYISIS_D2OisotropicRT
2D 1H-1H NOESYISIS_D2OisotropicRT
2D 1H-1H NOESYISIS_H2OisotropicRT
2D 1H-1H NOESYISIS_D2Oisotropic5C
2D 1H-1H NOESYISIS_H2Oisotropic5C
2D HP-COSYISIS_D2OisotropicRT
2D 1H-1H NOESYISIS_D2OanisotropicRT

Software:

SPARKY v3.115, Goddard - chemical shift assignment

VNMRJ v2.2C, Varian - collection

AMBER v9, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - structure solution

NMR spectrometers:

  • Varian Uniform NMR System 800 MHz
  • Varian Uniform NMR System 600 MHz

Related Database Links: