BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16812

Title: data-driven model of MED1:DNA complex   PubMed: 19095651

Authors: Lowry, Jason; Gamsjaeger, Roland; Thong, Sock Yue; Hung, Wendy; Kwan, Ann; Broitman-Maduro, Gina; Matthews, Jacqueline; Maduro, Morris; Mackay, Joel

Citation: Lowry, Jason; Gamsjaeger, Roland; Thong, Sock Yue; Hung, Wendy; Kwan, Ann; Broitman-Maduro, Gina; Matthews, Jacqueline; Maduro, Morris; Mackay, Joel. "Structural analysis of MED-1 reveals unexpected diversity in the mechanism of DNA recognition by GATA-type zinc finger domains."  J. Biol. Chem. 284, 5827-5835 (2009).

Assembly members:
MED1zf, polymer, 65 residues, 6728.883 Da.
ZN, non-polymer, 65.409 Da.
DNA, polymer, . residues, Formula weight is not available

Natural source:   Common Name: Caenorhabditis elegans   Taxonomy ID: 6239   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Caenorhabditis elegans

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
MED1zf: KSFQCSNCSVTETIRWRNIR SKEGIQCNACFIYQRKYNKT RPVTAVNKYQKRKLKVQETN GVDSF
DNA: CGGAAAAGTATACTTTTCCG

Data sets:
Data typeCount
13C chemical shifts145
15N chemical shifts65
1H chemical shifts299

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1MED1zf1
2ZINC ION2
3DNA3

Entities:

Entity 1, MED1zf 65 residues - 6728.883 Da.

1   LYSSERPHEGLNCYSSERASNCYSSERVAL
2   THRGLUTHRILEARGTRPARGASNILEARG
3   SERLYSGLUGLYILEGLNCYSASNALACYS
4   PHEILETYRGLNARGLYSTYRASNLYSTHR
5   ARGPROVALTHRALAVALASNLYSTYRGLN
6   LYSARGLYSLEULYSVALGLNGLUTHRASN
7   GLYVALASPSERPHE

Entity 2, ZINC ION - Zn - 65.409 Da.

1   ZN

Entity 3, DNA - Formula weight is not available

1   DCDGDGDADADADADGDTDA
2   DTDADCDTDTDTDTDCDCDG

Samples:

sample_1: sodium chloride 40 mM; potassium phosphate 20 mM; DTT 1 mM; H2O 90%; D2O 10%; protein, [U-100% 13C; U-100% 15N, 0.5 – 1 mM

sample_2: sodium chloride 40 mM; potassium phosphate 20 mM; DTT 1 mM; Pf1 phage 6 mg; H2O 90%; D2O 10%; protein, [U-100% 13C; U-100% 15N, 0.5 – 1 mM

sample_conditions_1: pH: 6.5; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HBHA(CO)NHsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
3D HNHAsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2anisotropicsample_conditions_1

Software:

CNS, Brunger A. T. et.al. - refinement

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker DRX 800 MHz

Related Database Links:

PDB
EMBL CAA92204 CCD72619
GB AAG21385 AAG21386
REF NP_498497 NP_510084