BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16609

Title: 1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin   PubMed: 20306311

Authors: Duchardt-Ferner, Elke; Schmidtke, Sina; Weigand, Julia; Suess, Beatrix; Woehnert, Jens

Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Weigand, Julia; Suess, Beatrix; Wohnert, Jens. "NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin"  Biomol. NMR Assign. 4, 115-118 (2010).

Assembly members:
Neo-Aptamer, polymer, 27 residues, Formula weight is not available
RIO, non-polymer, 454.473 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
Neo-Aptamer: GGCUGCUUGUCCUUUAAUGG UCCAGUC

Data sets:
Data typeCount
1H chemical shifts248
15N chemical shifts53
13C chemical shifts180
31P chemical shifts9

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1
2Aminoglycoside2

Entities:

Entity 1, RNA 27 residues - Formula weight is not available

1   GGCUGCUUGU
2   CCUUUAAUGG
3   UCCAGUC

Entity 2, Aminoglycoside - C17 H34 N4 O10 - 454.473 Da.

1   RIO

Samples:

sample_1: Neo-Aptamer 1.0 mM; Ribostamycin 1.1 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D20 10%

sample_2: Neo-Aptamer, [U-15N], 1.3 mM; Ribostamycin 1.4 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_3: Neo-Aptamer, [U-13C; U-15N], 1.4 mM; Ribostamycin 1.5 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_4: Neo-Aptamer, [U-13C; U-15N], 1.4 mM; Ribostamycin 1.5 mM; potassium cloride 50 mM; potassium phosphate 25 mM; D2O 100%

sample_5: Neo-Aptamer, [U-13C; U-15N; U-2H], 1.2 mM; Ribostamycin 1.3 mM; potassium cloride 50 mM; potassium phosphate 25 mM; D2O 100%

condition_1: pH: 6.2; pressure: 1 atm; temperature: 283 K

condition_2: pH: 6.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1D 1H-HS11ECHOsample_1isotropiccondition_1
2D 1H-1H NOESYsample_1isotropiccondition_1
2D 1H-15N HSQCsample_2isotropiccondition_1
2D 1H-15N-HNN-COSYsample_3isotropiccondition_1
2D 1H-13C-HNCOsample_3isotropiccondition_1
2D 1H-13C H5(6)C5(6)C4N3Hsample_3isotropiccondition_1
2D 1H-15N HCNsample_4isotropiccondition_2
3D 1H-15N NOESY-HSQCsample_2isotropiccondition_1
2D 1H-13C HSQCsample_3isotropiccondition_1
2D 1H-13C HSQCsample_4isotropiccondition_2
3D HCCH-COSYsample_4isotropiccondition_2
3D HCCH-TOCSYsample_4isotropiccondition_2
3D 1H-13C NOESY-HSQCsample_4isotropiccondition_2
3D 1H-13C NOESY-HMQCsample_4isotropiccondition_2
2D 1H-31Psample_4isotropiccondition_2

Software:

TOPSPIN v2.1, Bruker Biospin - collection, processing

CARA, Keller and Wuthrich - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 900 MHz
  • Bruker Avance 950 MHz

Related Database Links: