BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16604

Title: 1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with tobramycin   PubMed: 20306311

Authors: Schmidtke, Sina; Duchardt-Ferner, Elke; Weigand, Julia; Suess, Beatrix; Woehnert, Jens

Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Weigand, Julia; Suess, Beatrix; Woehnert, Jens. "NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin"  Biomol. NMR Assign. 4, 115-118 (2010).

Assembly members:
Neo-Riboswitch, polymer, 27 residues, 467.514 Da.
TOY, non-polymer, 467.514 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
Neo-Riboswitch: GGCUGCUUGUCCUUUAAUGG UCCAGUC

Data sets:
Data typeCount
13C chemical shifts174
15N chemical shifts49
1H chemical shifts235

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1
2Aminoglycoside2

Entities:

Entity 1, RNA 27 residues - 467.514 Da.

1   GGCUGCUUGU
2   CCUUUAAUGG
3   UCCAGUC

Entity 2, Aminoglycoside - C18 H37 N5 O9 - 467.514 Da.

1   TOY

Samples:

sample_1: Neo-Aptamer 1.1 mM; Tobramycin 1.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_2: Neo-Aptamer, [U-13C; U-15N], 1.1 mM; Tobramycin 1.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_3: Neo-Aptamer, [U-13C; U-15N], 1.1 mM; Tobramycin 1.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; D2O 100%

sample_4: Neo-Aptamer, [U-13C; U-15N]-Ura-Ade, 1.2 mM; Tobramycin 1.3 mM; potassium chloride 50 mM; potassium phosphate 25 mM; D2O 100%

condition_1: pH: 6.2; pressure: 1 atm; temperature: 283 K

condition_2: pH: 6.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1D 1H-HS11ECHOsample_1isotropiccondition_1
2D 1H-1H NOESYsample_1isotropiccondition_1
2D 1H-15N HSQCsample_2isotropiccondition_1
2D 1H-15N-HNN-COSYsample_2isotropiccondition_1
2D 1H-13C-HNCOsample_2isotropiccondition_1
2D 1H-13C H5(6)C5(6)C4N3Hsample_2isotropiccondition_1
2D 1H-15N HCNsample_3isotropiccondition_1
2D 1H-13C HSQCsample_2isotropiccondition_1
2D 1H-13C HSQCsample_3isotropiccondition_2
3D HCCH-COSYsample_3isotropiccondition_2
3D HCCH-TOCSYsample_3isotropiccondition_2
3D 1H-1H NOESY-HSQCsample_3isotropiccondition_2
3D 1H-1H NOESY-HMQCsample_3isotropiccondition_2
2D 1H-1H HCCH-TOCSY (Adenine)sample_3isotropiccondition_2
3D 1H-1H NOESY-HMQCsample_4isotropiccondition_2
2D 1H-13C HSQCsample_4isotropiccondition_2

Software:

TOPSPIN v2.1, Bruker Biospin - processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 900 MHz
  • Bruker Avance 950 MHz

Related Database Links: