BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16485

Title: Solution structure of the THAP zinc finger of THAP1 in complex with its DNA target   PubMed: 20144952

Authors: Campagne, Sebastien; Gervais, Virginie; Saurel, Olivier; Milon, Alain

Citation: Campagne, Sebastien; Saurel, Olivier; Gervais, Virginie; Milon, Alain. "Structural determinants of specific DNA-recognition by the THAP zinc finger."  Nucleic Acids Res. 38, 3466-3476 (2010).

Assembly members:
THAP_domain, polymer, 87 residues, Formula weight is not available
RRM1, polymer, 32 residues, Formula weight is not available
ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
THAP_domain: MVQSCSAYGCKNRYDKDKPV SFHKFPLTRPSLCKEWEAAV RRKNFKPTKYSSICSEHFTP DSFKRESNNKLLKENAVPTI FLELVPR
RRM1: GCTTGTGTGGGCAGCGCGCT GCCCACACAAGC

Data sets:
Data typeCount
13C chemical shifts351
15N chemical shifts84
1H chemical shifts892
heteronuclear NOE values73
residual dipolar couplings53
T1 relaxation values73
T2 relaxation values73

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1THAP_domain1
2RRM12
3ZN3

Entities:

Entity 1, THAP_domain 87 residues - Formula weight is not available

1   METVALGLNSERCYSSERALATYRGLYCYS
2   LYSASNARGTYRASPLYSASPLYSPROVAL
3   SERPHEHISLYSPHEPROLEUTHRARGPRO
4   SERLEUCYSLYSGLUTRPGLUALAALAVAL
5   ARGARGLYSASNPHELYSPROTHRLYSTYR
6   SERSERILECYSSERGLUHISPHETHRPRO
7   ASPSERPHELYSARGGLUSERASNASNLYS
8   LEULEULYSGLUASNALAVALPROTHRILE
9   PHELEUGLULEUVALPROARG

Entity 2, RRM1 32 residues - Formula weight is not available

1   DGDCDTDTDGDTDGDTDGDG
2   DGDCDADGDCDGDCDGDCDT
3   DGDCDCDCDADCDADCDADA
4   DGDC

Entity 3, ZN - Zn - 65.409 Da.

1   ZN

Samples:

sample_1: THAP domain, [U-100% 13C; U-100% 15N], 1 mM; RRM1 1 mM; D2O 10%; H2O 90%; NaCl 30 mM

sample_2: THAP domain 1 mM; RRM1 1 mM; D2O 10%; H2O 90%; NaCl 30 mM

sample_conditions_1: ionic strength: 0.03 M; pH: 6.8; pressure: 1 atm; temperature: 296 K

Experiments:

NameSampleSample stateSample conditions
3D HNCACBsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
3D 1H-15N TOCSYsample_1isotropicsample_conditions_1
3D H(CCO)NHsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D IPAP 15N HSQCsample_1isotropicsample_conditions_1
2D 15N HSQC T1sample_1isotropicsample_conditions_1
2D 15N HSQC T2sample_1isotropicsample_conditions_1
2D 15N HSQC Heteronuclear NOEsample_1isotropicsample_conditions_1

Software:

XEASY, Keller and Wuthrich - chemical shift assignment, data analysis

NMRView, Johnson, One Moon Scientific - data analysis

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 600 MHz

Related Database Links:

BMRB 15289
PDB
DBJ BAA91635 BAD96951 BAI45652
EMBL CAG33537 CAH90563
GB AAH21721 ADZ15806 AIC51723 EAW63205 EAW63206
REF NP_001125299 NP_001244808 NP_060575 XP_002757063 XP_003269699
SP Q5RCE4 Q9NVV9
. Hs.383396