BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16479

Title: 1H and 13C resonance assignments of a guanine sensing riboswitch's terminator hairpin   PubMed: 20204714

Authors: Ottink, Otmar; Westerweele, Ivo; Nelissen, Frank; Tessari, Marco; Heus, Hans; Wijmenga, Sybren

Citation: Ottink, Otmar; Westerweele, Ivo; Tesssari, Marco; Nelissen, Frank; Heus, Hans; Wijmenga, Sybren. "(1)H and (13)C resonance assignments of a guanine sensing riboswitch's terminator hairpin."  Biomol. NMR Assignments 4, 89-91 (2010).

Assembly members:
G-riboswitch_terminator_hairpin, polymer, 35 residues, Formula weight is not available

Natural source:   Common Name: Bacillus subtilis   Taxonomy ID: 1423   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Bacillus subtilis

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
G-riboswitch_terminator_hairpin: GGCAUUGCUUGCUCUUUAUU UGAGCGGGCAAUGCC

Data sets:
Data typeCount
13C chemical shifts90
1H chemical shifts119

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1subunit 11

Entities:

Entity 1, subunit 1 35 residues - Formula weight is not available

1   GGCAUUGCUU
2   GCUCUUUAUU
3   UGAGCGGGCA
4   AUGCC

Samples:

sample_1: G-riboswitch terminator hairpin 0.44 mM; D2O 7%; H2O 93%; NaPhosphate buffer (ph 6.7) 10 mM

sample_2: G-riboswitch terminator hairpin 0.44 mM; D2O 100%; NaPhosphate buffer (ph 6.7) 10 mM

sample_conditions_1: ionic strength: 10 mM; pH: 6.7; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Varian INOVA 800 MHz

Related Database Links: