BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 16431

Title: Complex of HIV-2 TAR RNA and a synthetic tripeptide in a 1:2 stoichiometry   PubMed: 19444830

Authors: Ferner, Jan; Suhartono, Marcel; Breitung, Sven; Jonker, Hendrik; Hennig, Mirko; Woehnert, Jens; Goebel, Michael; Schwalbe, Harald

Citation: Ferner, Jan; Suhartono, Marcel; Breitung, Sven; Jonker, Hendrik; Hennig, Mirko; Woehnert, Jens; Goebel, Michael; Schwalbe, Harald. "Structures of HIV TAR RNA-ligand complexes reveal higher binding stoichiometries"  ChemBioChem 10, 1490-1494 (2009).

Assembly members:
UUCG-TAR, polymer, 28 residues, Formula weight is not available
Pyrimidinylpeptide, polymer, 3 residues, Formula weight is not available

Natural source:   Common Name: AIDS virus   Taxonomy ID: 11709   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
UUCG-TAR: GGCCAGAUUGAGCUUCGGCU CUCUGGUC
Pyrimidinylpeptide: XXX

Data sets:
Data typeCount
13C chemical shifts172
15N chemical shifts57
1H chemical shifts236

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1UUCG-TAR1
2LIG12
3LIG22

Entities:

Entity 1, UUCG-TAR 28 residues - Formula weight is not available

1   GGCCAGAUUG
2   AGCUUCGGCU
3   CUCUGGUC

Entity 2, LIG1 3 residues - Formula weight is not available

2X=PPA (2-amino-5-(pyrimidin-2-yl)pentanoic acid)

1   DARPPADAR

Samples:

sample_1: UUCG-TAR, [U-100% 13C; U-100% 15N], 0.65 mM; Pyrimidinylpeptide 5.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_2: UUCG-TAR, [U-100% 13C; U-100% 15N], 0.65 mM; Pyrimidinylpeptide 5.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; D2O 100%

sample_3: UUCG-TAR 0.65 mM; Pyrimidinylpeptide 5.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%

sample_4: UUCG-TAR 0.65 mM; Pyrimidinylpeptide 5.2 mM; potassium chloride 50 mM; potassium phosphate 25 mM; D2O 100%

sample_5: UUCG-TAR, [U-100% 13C; U-100% 15N], 0.2 mM; Pyrimidinylpeptide 0.8 mM; potassium chloride 50 mM; potassium phosphate 25 mM; Pf1 phage 16 mg/mL; D2O 100%

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
3D HCCH-COSYsample_2isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_2
3D 1H-13C NOESYsample_2isotropicsample_conditions_1
2D H(C)Nsample_2isotropicsample_conditions_1
2D 1H-15N HSQC (2J)sample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2anisotropicsample_conditions_1
2D HNN-COSYsample_1isotropicsample_conditions_2
2D H5NN-COSYsample_2isotropicsample_conditions_1
3D forward-directed HCC-TOCSY-CCH E.COSYsample_2isotropicsample_conditions_1
2D 1H-15N CPMG-NOESYsample_1isotropicsample_conditions_2

Software:

TOPSPIN v2.1, Bruker Biospin - collection, data analysis, processing

SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

ARIA v1.2, Linge, O'Donoghue and Nilges - refinement

HADDOCK v2.1, Dominguez, Boelens and Bonvin - refinement

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker DRX 600 MHz
  • Bruker Avance 400 MHz

Related Database Links: