BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15859

Title: NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)

Authors: Kruschel, Daniela; Sigel, Roland

Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme"  Not known ., .-..

Assembly members:
RNA_(22-MER), polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
RNA_(22-MER): GGAGUAUGUGAAAGCAUACU CC

Data sets:
Data typeCount
13C chemical shifts58
15N chemical shifts11
1H chemical shifts183

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (22-MER)1

Entities:

Entity 1, RNA (22-MER) 22 residues - Formula weight is not available

1   GGAGUAUGUG
2   AAAGCAUACU
3   CC

Samples:

sample_1: RNA (22-MER) 0.9-1.3 mM; potassium chloride 10 mM; EDTA 10 uM; D2O, [U-100% 2H], 100%

sample_2: RNA (22-MER) 0.9-1.3 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_3: RNA (22-MER), [U-100% 13C; U-100% 15N], 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; D2O, [U-100% 2H], 100%

sample_4: RNA (22-MER), [U-100% 13C; U-100% 15N], 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 10 mM; pD: 6.45; pressure: 1 atm; temperature: 293 K

sample_conditions_5: ionic strength: 10 mM; pD: 6.45; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 10 mM; pH: 6.2; pressure: 1 atm; temperature: 278 K

sample_conditions_6: ionic strength: 10 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K

sample_conditions_3: ionic strength: 10 mM; pD: 6.8; pressure: 1 atm; temperature: 303 K

sample_conditions_4: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_3isotropicsample_conditions_3
2D 1H-15N HSQCsample_4isotropicsample_conditions_4
2D JNN HNN-COSYsample_4isotropicsample_conditions_4

Software:

TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - processing

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

DYANA v1.5, Guntert, Braun and Wuthrich - structure solution

CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH v2.16, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: