BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15786

Title: 1H,13C and 15N NMR assignments of duck HBV primer loop of the epsilon encapsidation signal   PubMed: 19636890

Authors: Van der Werf, Ramon; Girard, Frederic; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren

Citation: Van der Werf, Ramon; Girard, Frederic; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren. "1H, 13C and 15N NMR assignments of Duck HBV primer loop of the encapsidation signal epsilon"  Biomol. NMR Assignments 2, 143-145 (2008).

Assembly members:
EDHBVwt, polymer, 37 residues, Formula weight is not available

Natural source:   Common Name: Hepatitis B Virus   Taxonomy ID: 10407   Superkingdom: Viruses   Kingdom: not available   Genus/species: Orthohepadnavirus Hepatitis B Virus

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
EDHBVwt: GGACGAUCUUUACGUCCGCU UCGGCGGACUGUCGUCC

Data typeCount
13C chemical shifts187
15N chemical shifts50
1H chemical shifts285

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1primer_loop1

Entities:

Entity 1, primer_loop 37 residues - Formula weight is not available

1   GGACGAUCUU
2   UACGUCCGCU
3   UCGGCGGACU
4   GUCGUCC

Samples:

unlabeled(H2O): EDHBVwt 0.19 ± 0.01 mM; sodium phosphate 10 ± 0.5 mM; EDTA 0.1 ± 0.05 mM

labeled(H2O): EDHBVwt, [U-99% 13C; U-99% 15N], 1.00 ± 0.05 mM; EDTA 0.1 ± 0.05 mM; sodium phosphate 10 ± 0.5 mM; DSS 1.5 ± 0.05 mM

unlabeled(D2O): EDHBVwt 0.19 ± 0.01 mM; sodium phosphate 10 ± 0.5 mM; EDTA 0.1 ± 0.05 mM

5C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K

15C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K

25C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

5C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K

15C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K

25C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYunlabeled(H2O)isotropic15C_unlabelled
2D HCCH-COSYlabeled(H2O)isotropic25C_labelled
2D H1/3(N1/3)C2labeled(H2O)isotropic25C_labelled
2D 1H-15N HSQClabeled(H2O)isotropic15C_labelled
2D 1H-1H NOESYunlabeled(D2O)isotropic25C_unlabelled
2D DQF-COSYunlabeled(D2O)isotropic25C_unlabelled
2D 1H-15N HSQClabeled(H2O)isotropic5C_labelled
2D 1H-13C HSQClabeled(H2O)isotropic15C_labelled
H5(C5)C4labeled(H2O)isotropic15C_labelled
3D HCCH-TOCSYlabeled(H2O)isotropic25C_labelled
3D-HCNlabeled(H2O)isotropic25C_labelled
H1/3(N1/3)C4/6labeled(H2O)isotropic25C_labelled
2D 1H-15N HSQClabeled(H2O)isotropic15C_labelled

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, collection, peak picking

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: