BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15697

Title: Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites

Authors: Thiviyanathan, Varatharasa; Kulasegaran, Raghav; Kaluarachchi, Kumaralal; Gorenstein, David

Citation: Thiviyanathan, Varatharasa; Kulasegaran, Raghav; Kaluarachchi, Kumaralal; Rijnbrand, Rene; Gorenstein, David. "Mutational and Structural Analysis of Stem-loop IIId of the Hepatitis C Virus and GB Virus B Internal Ribosome Entry Sites"  J. Virology ., .-..

Assembly members:
GBV_B_IRES, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: GB virus B   Taxonomy ID: 39113   Superkingdom: Viruses   Kingdom: not available   Genus/species: not available GB virus B

Experimental source:   Production method: enzymatic synthesis

Entity Sequences (FASTA):
GBV_B_IRES: GGAUGGUUGGGGUUAGCCAU CC

Data sets:
Data typeCount
1H chemical shifts179

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1domain IIId1

Entities:

Entity 1, domain IIId 22 residues - Formula weight is not available

1   GGAUGGUUGG
2   GGUUAGCCAU
3   CC

Samples:

sample_1: GBV_B_IRES 1.2 mM; potassium chloride 10 mM; sodium phosphate 10 mM; EDTA 0.05 mM

sample_conditions_1: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1

Software:

VNMR, Varian - chemical shift assignment

NMR spectrometers:

  • Varian INOVA 750 MHz
  • Varian INOVA 600 MHz

Related Database Links: