BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15656

Title: Apical Stem Loop Duck HBV   PubMed: 19636894

Authors: Ampt, Kirsten; Ottink, Otmar; Girard, Fred; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren

Citation: Ampt, Kirsten; Ottink, Otmar; Girard, Fred; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren. "1H, 13C and 15N NMR assignments of Duck HBV apical stem loop of the epsilon encapsidation signal"  Biomol. NMR Assignments 2, 159-162 (2008).

Assembly members:
Duck_HBV_apical_loop, polymer, 29 residues, Formula weight is not available

Natural source:   Common Name: Hepatitis B virus   Taxonomy ID: 10407   Superkingdom: Viruses   Kingdom: not available   Genus/species: Orthohepadnavirus Hepatitis B virus

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Duck_HBV_apical_loop: GGUCUACAUUGCUGUUGUCG UGUGUGACC

Data typeCount
13C chemical shifts194
15N chemical shifts45
1H chemical shifts315

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1APIC1

Entities:

Entity 1, APIC 29 residues - Formula weight is not available

1   GGUCUACAUU
2   GCUGUUGUCG
3   UGUGUGACC

Samples:

sample_1: Duck HBV apical loop 1.2 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; H2O 95%; D2O 5%

sample_2: Duck HBV apical loop 1.2 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; D2O 100%

sample_3: Duck HBV apical loop, [U-13C; U-15N]-Ura, 1 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; D2O 5%; H2O 95%

sample_4: Duck HBV apical loop, [U-13C; U-15N]-Ura, 1 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; D2O 100%

sample_5: Duck HBV apical loop, [U-13C; U-15N], 0.7 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; D2O 5%; H2O 95%; DSS 1 mM

sample_6: Duck HBV apical loop, [U-13C; U-15N], 0.7 mM; sodium phosphate buffer 10 mM; EDTA 0.1 mM; D2O 5%; H2O 95%; Pf1 phage 15 mg/ml

sample_conditions_1: ionic strength: 10 mM; pH: 6.7; pressure: 1 atm; temperature: 278 K

sample_conditions_2: ionic strength: 10 mM; pH: 6.7; pressure: 1 atm; temperature: 288 K

sample_conditions_3: ionic strength: 10 mM; pH: 6.7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
3D 1H-13C NOESYsample_5isotropicsample_conditions_2
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_3
2D 1H-13C HSQCsample_4isotropicsample_conditions_3
2D 1H-13C HSQCsample_5isotropicsample_conditions_2
2D DQF-COSYsample_2isotropicsample_conditions_3
2D 1H-1H COSYsample_5isotropicsample_conditions_2
3D HCCH-TOCSYsample_5isotropicsample_conditions_2
3D HCNsample_5isotropicsample_conditions_2

Software:

SPARKY, Goddard - chemical shift assignment, peak picking

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: