BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15538

Title: Structure of a high affinity anti-NFkB RNA aptamer   PubMed: 18160411

Authors: Reiter, Nicholas; Maher, L. James; Butcher, Samuel

Citation: Reiter, Nicholas; Maher, L. James; Butcher, Samuel. "DNA mimicry by a high affinity anti-NF-kB RNA apatamer"  Nucleic Acids Res. 36, 1227-1236 (2008).

Assembly members:
RNA, polymer, 29 residues, 132.116 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology   Host organism: not applicable

Entity Sequences (FASTA):
RNA: GAUACUUGAAACUGUAAGGU UGGCGUAUC

Data sets:
Data typeCount
13C chemical shifts193
15N chemical shifts31
1H chemical shifts256

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1

Entities:

Entity 1, RNA 29 residues - 132.116 Da.

1   GAUACUUGAA
2   ACUGUAAGGU
3   UGGCGUAUC

Samples:

sample_1: RNA, [U-99% 13C; U-99% 15N], 1 ± 0.2 mM; KCl 50 mM; H20 90%; D2O 10%

Sample_D2O: RNA 1 ± 0.2 mM; D2O 100%

sample_conditions_1: ionic strength: 0.05 M; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYSample_D2Oisotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYSample_D2Oisotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1

Software:

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Varian INOVA 900 MHz
  • Bruker DMX 750 MHz

Related Database Links:

PDB