BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15417

Title: Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV   PubMed: 17868691

Authors: Marcheschi, Ryan; Staple, David; Butcher, Samuel

Citation: Marcheschi, Ryan; Staple, David; Butcher, Samuel. "Programmed Ribosomal Frameshifting in SIV is Induced by a Highly Structured RNA Stem-Loop"  J. Mol. Biol. 373, 652-663 (2007).

Assembly members:
SIV_RNA_(34-MER), polymer, 34 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
SIV_RNA_(34-MER): GGAUGGGGAAAGAAGCCCCG CAAUUUCCCCAUCC

Data sets:
Data typeCount
13C chemical shifts137
15N chemical shifts11
1H chemical shifts249

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1

Entities:

Entity 1, RNA 34 residues - Formula weight is not available

1   GGAUGGGGAA
2   AGAAGCCCCG
3   CAAUUUCCCC
4   AUCC

Samples:

sample_1: SIV17-50 RNA (34-MER) 1 mM; H2O 90%; D2O 10%

sample_2: SIV17-50 RNA (34-MER) 1 mM; H2O 90%; D2O 10%

sample_3: SIV17-50 RNA (34-MER), [U-100% 13C; U-100% 15N], 1 mM; H2O 90%; D2O 10%

sample_4: SIV17-50 RNA (34-MER), [U-100% 13C; U-100% 15N], 1 mM; H2O 90%; D2O 10%

sample_conditions_1: pH: 7.0; pressure: 1 atm; temperature: 277 K

sample_conditions_2: pH: 7.0; pressure: 1 atm; temperature: 283 K

sample_conditions_3: pH: 7.0; pressure: 1 atm; temperature: 303 K

sample_conditions_4: pH: 7.0; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
3D 1H-13C-1H HCCH-TOCSYsample_4isotropicsample_conditions_1
3D NOESY-HMQCsample_4isotropicsample_conditions_1
J-MODULATED 1H-13C CT-HSQCsample_3isotropicsample_conditions_1
J-MODULATED 1H-13C CT-HSQCsample_3anisotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

xwinnmr v3.5, Bruker Biospin - collection, processing

SPARKY v3.111, Goddard - data analysis, peak picking

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

VNMR, Varian - collection

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, peak picking, processing

NMR spectrometers:

  • Bruker DMX 750 MHz
  • Bruker DMX 600 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz
  • Bruker DMX 500 MHz
  • Varian INOVA 900 MHz

Related Database Links: