BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15257

Title: Structural basis of RsmA/CsrA RNA recognition: Structure of RsmE bound to the Shine-Dalgarno sequence of hcnA mRNA   PubMed: 17704818

Authors: Schubert, Mario; Lapouge, Karine; Duss, Olivier; Oberstrass, Florian; Jelesarov, Ilian; Haas, Dieter; Allain, Frederic

Citation: Schubert, Mario; Lapouge, Karine; Duss, Olivier; Oberstrass, Florian; Jelesarov, Ilian; Haas, Dieter; Allain, Frederic. "Molecular basis of messenger RNA recognition by the specific bacterial repressing clamp RsmA/CsrA."  Nat. Struct. Mol. Biol. 14, 807-813 (2007).

Assembly members:
hncA_mRNA_SD_20mer, polymer, 20 residues, 6437.938 Da.
RsmE, polymer, 70 residues, 5851.832 Da.

Natural source:   Common Name: not available   Taxonomy ID: 294   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Pseudomonas fluorescens

Experimental source:   Production method: in vitro transcription   Host organism: Pseudomonas fluorescens

Entity Sequences (FASTA):
hncA_mRNA_SD_20mer: GGGCUUCACGGAUGAAGCCC
RsmE: MLILTRKVGESINIGDDITI TILGVSGQQVRIGINAPKDV AVHREEIYQRIQAGLTAPDK RETPHHHHHH

Data sets:
Data typeCount
13C chemical shifts340
15N chemical shifts77
1H chemical shifts625

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
120 mer, 11
220 mer, 21
3RsmE A2
4RsmE B2

Entities:

Entity 1, 20 mer, 1 20 residues - 6437.938 Da.

1   GGGCUUCACG
2   GAUGAAGCCC

Entity 2, RsmE A 70 residues - 5851.832 Da.

1   METLEUILELEUTHRARGLYSVALGLYGLU
2   SERILEASNILEGLYASPASPILETHRILE
3   THRILELEUGLYVALSERGLYGLNGLNVAL
4   ARGILEGLYILEASNALAPROLYSASPVAL
5   ALAVALHISARGGLUGLUILETYRGLNARG
6   ILEGLNALAGLYLEUTHRALAPROASPLYS
7   ARGGLUTHRPROHISHISHISHISHISHIS

Samples:

sample_1: RsmE, [U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; H2O 97%; D2O 3%; NaCl 30 mM; K2HPO4 50 mM

sample_2: RsmE, [U-100% 13C; U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; D2O 100%; NaCl 30 mM; K2HPO4 50 mM

sample_3: RsmE, [U-100% 13C; U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; H2O 97%; D2O 3%; NaCl 30 mM; K2HPO4 50 mM

sample_4: RsmE, [U-100% 15N], 1 mM; hncA_mRNA_SD_20mer 1 mM; D2O 100%; NaCl 30 mM; K2HPO4 50 mM

sample_conditions_1: ionic strength: 0.18 M; pH: 7.2; pressure: 1 atm; temperature: 313.15 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_3isotropicsample_conditions_1
3D HNCAsample_3isotropicsample_conditions_1
3D HNCACBsample_3isotropicsample_conditions_1
3D HNCOsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
3D H(CCO)NHsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
3D 1H-13C NOESYsample_3isotropicsample_conditions_1
3D HN(CO)CAsample_3isotropicsample_conditions_1

Software:

AMBER v7.0, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Koll - refinement

DYANA v3.02, Guntert, Braun and Wuthrich - geometry optimization

SPARKY, Goddard - chemical shift assignment, data analysis

CCP4, CCP4 Executuve Committee - rename chains, superpose ensemble

NMR spectrometers:

  • Bruker DMX 500 MHz
  • Bruker DMX 600 MHz
  • Bruker DMX 750 MHz
  • Bruker Avance 900 MHz

Related Database Links:

BMRB 19534 19544 19546 19547 19548 19549
PDB
DBJ BAO61455 BAQ73744 BAQ80031
GB AAT27429 AAY91370 AEL31265 AGL83913 AIC19187
REF WP_007920550 WP_017337657 WP_045057924 WP_057444113